Incidental Mutation 'R6171:Elk3'
ID490449
Institutional Source Beutler Lab
Gene Symbol Elk3
Ensembl Gene ENSMUSG00000008398
Gene NameELK3, member of ETS oncogene family
SynonymsNet, D430049E23Rik, Erp, Sap-2
MMRRC Submission 044314-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R6171 (G1)
Quality Score184.009
Status Validated
Chromosome10
Chromosomal Location93247414-93311135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93250044 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 132 (P132Q)
Ref Sequence ENSEMBL: ENSMUSP00000121754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008542] [ENSMUST00000129827] [ENSMUST00000151153] [ENSMUST00000215286] [ENSMUST00000223340]
Predicted Effect probably damaging
Transcript: ENSMUST00000008542
AA Change: P399Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008542
Gene: ENSMUSG00000008398
AA Change: P399Q

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 222 N/A INTRINSIC
low complexity region 229 256 N/A INTRINSIC
low complexity region 278 299 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129827
SMART Domains Protein: ENSMUSP00000122324
Gene: ENSMUSG00000008398

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 217 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151153
AA Change: P132Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121754
Gene: ENSMUSG00000008398
AA Change: P132Q

DomainStartEndE-ValueType
ETS 4 80 7.6e-36 SMART
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215286
Predicted Effect probably benign
Transcript: ENSMUST00000216729
Predicted Effect probably benign
Transcript: ENSMUST00000223340
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a null allele develop a vascular defect associated with lymphangiectasis and die prematurely due to respiratory failure resulting from chylothorax. Homozygotes for a different null allele show a transient delay in retinal primary plexus vascularization and tortuous retinal arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 A G 4: 126,317,317 V269A probably damaging Het
Atp11a T A 8: 12,832,663 V517D probably damaging Het
Atr C T 9: 95,881,271 Q1073* probably null Het
C87436 A C 6: 86,445,467 T8P probably benign Het
Clasrp T C 7: 19,584,822 probably benign Het
Creb3l1 G T 2: 91,991,269 Q254K probably damaging Het
Dapl1 C A 2: 59,496,602 T64K probably benign Het
Dnah2 A T 11: 69,423,042 L4168Q probably damaging Het
Dnttip2 T A 3: 122,278,862 I597N probably damaging Het
Dyrk1b A T 7: 28,186,550 probably null Het
Galt C T 4: 41,757,541 P238S probably damaging Het
Gm10322 T C 10: 59,616,262 V67A possibly damaging Het
Ice1 T C 13: 70,606,731 Y412C probably benign Het
Kcna1 A T 6: 126,642,323 Y345N probably damaging Het
Kif1b T C 4: 149,258,048 Y419C probably damaging Het
Klf15 G T 6: 90,466,619 A59S possibly damaging Het
Mettl17 T A 14: 51,888,779 Y162N probably damaging Het
Myh10 G A 11: 68,791,890 R1050Q probably damaging Het
Nek4 T C 14: 30,970,347 V376A probably benign Het
Nemp1 T A 10: 127,689,450 probably null Het
Nlrp9a T C 7: 26,558,763 I602T possibly damaging Het
Nphp4 T C 4: 152,544,449 V764A probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr895 C T 9: 38,268,602 Q22* probably null Het
Osbp2 A T 11: 3,717,221 probably null Het
Pax2 A G 19: 44,790,740 Y185C probably damaging Het
Pdyn A T 2: 129,688,348 S134T possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppp1r13l A G 7: 19,377,511 M754V probably benign Het
Prr23a3 T A 9: 98,865,678 N228K probably benign Het
Psmd12 T C 11: 107,491,907 F213L probably damaging Het
Qser1 A T 2: 104,789,283 S395T probably damaging Het
Rab7b A G 1: 131,698,634 probably null Het
Rev3l T A 10: 39,862,713 L2821* probably null Het
Rplp0 A G 5: 115,561,160 N127S probably benign Het
Serpina9 G T 12: 104,008,419 Y158* probably null Het
Sis G A 3: 72,961,027 T110M possibly damaging Het
Slc43a2 A G 11: 75,563,050 Y263C probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stard13 A T 5: 151,092,762 V88E probably damaging Het
Trim29 G A 9: 43,319,377 E286K probably damaging Het
Vmn2r24 T C 6: 123,787,246 S361P probably damaging Het
Wnk2 T C 13: 49,060,832 T18A probably damaging Het
Xylb C T 9: 119,381,591 T380M probably damaging Het
Zbtb5 T C 4: 44,994,119 T422A probably benign Het
Zhx2 A G 15: 57,823,206 E657G probably damaging Het
Other mutations in Elk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Elk3 APN 10 93284827 missense probably damaging 1.00
IGL02566:Elk3 APN 10 93265463 missense probably damaging 1.00
IGL03251:Elk3 APN 10 93254821 splice site probably null
R0308:Elk3 UTSW 10 93265205 missense probably benign
R0594:Elk3 UTSW 10 93265160 missense probably damaging 1.00
R0601:Elk3 UTSW 10 93265481 missense probably damaging 0.98
R1190:Elk3 UTSW 10 93265196 missense probably benign 0.00
R2021:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2022:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2418:Elk3 UTSW 10 93284827 missense probably damaging 1.00
R3935:Elk3 UTSW 10 93265173 missense possibly damaging 0.60
R4167:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4168:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4169:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4170:Elk3 UTSW 10 93265335 critical splice donor site probably null
R5864:Elk3 UTSW 10 93284791 missense probably damaging 1.00
R6743:Elk3 UTSW 10 93265050 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCCATGTTACGAAAAGTGCAAACC -3'
(R):5'- AATAGGGGCATTTTCTGGGCC -3'

Sequencing Primer
(F):5'- CAAATGAACCAGGTTTCACAATGTC -3'
(R):5'- GGTAACCTTTGTAAAGCAACTCAGC -3'
Posted On2017-10-10