Incidental Mutation 'R6171:Ice1'
ID490456
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
MMRRC Submission 044314-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R6171 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70606731 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 412 (Y412C)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
Predicted Effect probably benign
Transcript: ENSMUST00000043493
AA Change: Y412C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: Y412C

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 A G 4: 126,317,317 V269A probably damaging Het
Atp11a T A 8: 12,832,663 V517D probably damaging Het
Atr C T 9: 95,881,271 Q1073* probably null Het
C87436 A C 6: 86,445,467 T8P probably benign Het
Clasrp T C 7: 19,584,822 probably benign Het
Creb3l1 G T 2: 91,991,269 Q254K probably damaging Het
Dapl1 C A 2: 59,496,602 T64K probably benign Het
Dnah2 A T 11: 69,423,042 L4168Q probably damaging Het
Dnttip2 T A 3: 122,278,862 I597N probably damaging Het
Dyrk1b A T 7: 28,186,550 probably null Het
Elk3 G T 10: 93,250,044 P132Q probably damaging Het
Galt C T 4: 41,757,541 P238S probably damaging Het
Gm10322 T C 10: 59,616,262 V67A possibly damaging Het
Kcna1 A T 6: 126,642,323 Y345N probably damaging Het
Kif1b T C 4: 149,258,048 Y419C probably damaging Het
Klf15 G T 6: 90,466,619 A59S possibly damaging Het
Mettl17 T A 14: 51,888,779 Y162N probably damaging Het
Myh10 G A 11: 68,791,890 R1050Q probably damaging Het
Nek4 T C 14: 30,970,347 V376A probably benign Het
Nemp1 T A 10: 127,689,450 probably null Het
Nlrp9a T C 7: 26,558,763 I602T possibly damaging Het
Nphp4 T C 4: 152,544,449 V764A probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr895 C T 9: 38,268,602 Q22* probably null Het
Osbp2 A T 11: 3,717,221 probably null Het
Pax2 A G 19: 44,790,740 Y185C probably damaging Het
Pdyn A T 2: 129,688,348 S134T possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppp1r13l A G 7: 19,377,511 M754V probably benign Het
Prr23a3 T A 9: 98,865,678 N228K probably benign Het
Psmd12 T C 11: 107,491,907 F213L probably damaging Het
Qser1 A T 2: 104,789,283 S395T probably damaging Het
Rab7b A G 1: 131,698,634 probably null Het
Rev3l T A 10: 39,862,713 L2821* probably null Het
Rplp0 A G 5: 115,561,160 N127S probably benign Het
Serpina9 G T 12: 104,008,419 Y158* probably null Het
Sis G A 3: 72,961,027 T110M possibly damaging Het
Slc43a2 A G 11: 75,563,050 Y263C probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stard13 A T 5: 151,092,762 V88E probably damaging Het
Trim29 G A 9: 43,319,377 E286K probably damaging Het
Vmn2r24 T C 6: 123,787,246 S361P probably damaging Het
Wnk2 T C 13: 49,060,832 T18A probably damaging Het
Xylb C T 9: 119,381,591 T380M probably damaging Het
Zbtb5 T C 4: 44,994,119 T422A probably benign Het
Zhx2 A G 15: 57,823,206 E657G probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 intron probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTTATCCACCTCCCTGG -3'
(R):5'- TGTGCTGACAGTGACTATGTGC -3'

Sequencing Primer
(F):5'- GGCCTCCACCATTCTTTCTG -3'
(R):5'- CTTTGTGTGACTTTAAGGAATCCTTC -3'
Posted On2017-10-10