Incidental Mutation 'R0529:Vmn1r7'
Institutional Source Beutler Lab
Gene Symbol Vmn1r7
Ensembl Gene ENSMUSG00000093696
Gene Namevomeronasal 1 receptor 7
SynonymsGm5568, V1rc31
MMRRC Submission 038721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R0529 (G1)
Quality Score225
Status Validated
Chromosomal Location57024106-57025324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57024465 bp
Amino Acid Change Tyrosine to Phenylalanine at position 270 (Y270F)
Ref Sequence ENSEMBL: ENSMUSP00000135571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000176252
AA Change: Y270F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135571
Gene: ENSMUSG00000093696
AA Change: Y270F

Pfam:V1R 28 293 1.1e-59 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 8,992,396 V126I probably benign Het
Aasdh A C 5: 76,876,267 Y179* probably null Het
Afp A G 5: 90,504,395 Y415C probably damaging Het
Aldh5a1 G T 13: 24,913,873 T393K probably benign Het
Arhgef26 T C 3: 62,339,725 S77P probably benign Het
Axl A G 7: 25,787,287 probably benign Het
Card10 A G 15: 78,780,475 probably null Het
Ccdc71l G A 12: 32,379,252 S90N probably damaging Het
Cebpa A T 7: 35,120,199 T261S probably benign Het
Cnmd T C 14: 79,642,041 E219G probably benign Het
Cntln T A 4: 85,067,825 L1010H probably damaging Het
Cul9 A G 17: 46,520,468 probably benign Het
Cyld A G 8: 88,729,759 E479G probably benign Het
Dmp1 A G 5: 104,212,226 E256G probably benign Het
Dnmt1 T C 9: 20,911,550 D1140G probably damaging Het
Drd2 A C 9: 49,407,074 M439L probably benign Het
Drd3 G A 16: 43,822,714 V438M probably damaging Het
Dyrk3 A G 1: 131,130,121 I70T probably benign Het
Fam46c A G 3: 100,472,370 Y357H probably benign Het
Fbxo38 T C 18: 62,505,986 K1082E probably damaging Het
Fbxw10 A C 11: 62,859,845 D428A probably damaging Het
Fmn1 T A 2: 113,707,853 probably benign Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Gda T A 19: 21,425,537 I82F probably damaging Het
Gpatch4 T A 3: 88,051,276 H22Q probably damaging Het
Gpr55 A G 1: 85,941,503 F119L probably benign Het
Gtf2i A T 5: 134,261,869 L425* probably null Het
Knstrn T A 2: 118,830,980 probably benign Het
Lipo2 T A 19: 33,746,935 I144L probably benign Het
Lrp1 T C 10: 127,541,594 probably null Het
Mtmr14 T C 6: 113,266,252 probably benign Het
Nsmce4a A T 7: 130,533,806 S345R probably benign Het
Oacyl T A 18: 65,742,219 V385D probably damaging Het
Olfr421-ps1 G A 1: 174,152,130 A205T probably benign Het
Olfr917 A T 9: 38,665,512 C111S probably benign Het
Phlpp2 T C 8: 109,876,971 S55P probably benign Het
Pkhd1l1 T A 15: 44,526,754 V1422E possibly damaging Het
Plcd3 T G 11: 103,080,187 H181P probably benign Het
Psmc5 G A 11: 106,261,164 probably null Het
Psmd11 T C 11: 80,470,689 probably benign Het
Rab39 T C 9: 53,686,716 Y83C probably damaging Het
Ric8a A G 7: 140,860,893 E93G probably damaging Het
Rtp3 T C 9: 110,987,084 E133G possibly damaging Het
Serpina1e A C 12: 103,949,104 L281R probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tmem63a A T 1: 180,961,094 E332V probably benign Het
Tnk1 T C 11: 69,855,164 T312A probably damaging Het
Traf3ip3 G T 1: 193,194,811 probably benign Het
Trappc11 A G 8: 47,526,979 V174A possibly damaging Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn2r12 A G 5: 109,092,848 V133A probably benign Het
Vmn2r18 T A 5: 151,562,523 E502V probably damaging Het
Wipf3 C A 6: 54,485,363 P186Q probably damaging Het
Yipf5 A T 18: 40,212,162 M55K probably benign Het
Zbtb7a G A 10: 81,143,986 V5M probably damaging Het
Zfy1 G T Y: 726,040 S575Y probably damaging Het
Other mutations in Vmn1r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Vmn1r7 APN 6 57024723 missense probably damaging 1.00
IGL01528:Vmn1r7 APN 6 57024547 missense probably benign
IGL02024:Vmn1r7 APN 6 57024889 missense probably benign 0.01
IGL02234:Vmn1r7 APN 6 57024552 missense probably damaging 0.98
IGL02610:Vmn1r7 APN 6 57025052 missense probably benign 0.01
IGL02691:Vmn1r7 APN 6 57024388 missense probably benign 0.05
R0548:Vmn1r7 UTSW 6 57025081 missense probably damaging 0.96
R1254:Vmn1r7 UTSW 6 57024787 missense probably damaging 1.00
R1279:Vmn1r7 UTSW 6 57024949 missense possibly damaging 0.63
R1582:Vmn1r7 UTSW 6 57025158 missense probably damaging 1.00
R1973:Vmn1r7 UTSW 6 57025026 missense probably benign 0.00
R1991:Vmn1r7 UTSW 6 57024868 missense probably benign 0.37
R2160:Vmn1r7 UTSW 6 57024894 missense probably damaging 0.97
R3546:Vmn1r7 UTSW 6 57024849 missense possibly damaging 0.80
R3547:Vmn1r7 UTSW 6 57024849 missense possibly damaging 0.80
R5901:Vmn1r7 UTSW 6 57024606 missense probably damaging 1.00
R6294:Vmn1r7 UTSW 6 57024419 missense probably benign 0.00
R7063:Vmn1r7 UTSW 6 57024433 missense possibly damaging 0.63
R7192:Vmn1r7 UTSW 6 57024467 missense probably benign 0.00
R7647:Vmn1r7 UTSW 6 57025270 missense probably benign 0.01
R7781:Vmn1r7 UTSW 6 57024568 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gggcaccagaaatacaaacatac -3'
Posted On2013-06-12