Incidental Mutation 'R5848:Espl1'
ID 490476
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 043225-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5848 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 102231011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1837 (V1837I)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000229050] [ENSMUST00000169637] [ENSMUST00000170627]
AlphaFold P60330
Predicted Effect probably benign
Transcript: ENSMUST00000001335
SMART Domains Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
SCOP:d1fxkc_ 12 58 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062492
SMART Domains Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064924
AA Change: V1837I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V1837I

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165671
SMART Domains Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 75 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165717
SMART Domains Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 72 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166658
SMART Domains Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 22 143 8.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229050
AA Change: V1837I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168805
Predicted Effect probably benign
Transcript: ENSMUST00000229942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230222
Predicted Effect probably benign
Transcript: ENSMUST00000169637
SMART Domains Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 1 58 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170627
SMART Domains Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

DomainStartEndE-ValueType
Pfam:Prefoldin 7 99 4.6e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
Aadacl4 T A 4: 144,344,428 (GRCm39) M68K probably benign Het
Abca8b C A 11: 109,868,639 (GRCm39) G175V probably damaging Het
Cdcp1 T A 9: 123,012,770 (GRCm39) H259L possibly damaging Het
Ckap4 T C 10: 84,369,354 (GRCm39) Q126R probably benign Het
Clec18a C T 8: 111,802,093 (GRCm39) V299I probably benign Het
D7Ertd443e A G 7: 133,951,451 (GRCm39) I27T possibly damaging Het
Dlg2 T G 7: 92,093,735 (GRCm39) D726E probably benign Het
Dnah8 T C 17: 30,947,165 (GRCm39) I1856T possibly damaging Het
Fanca G T 8: 124,021,792 (GRCm39) probably benign Het
Fer1l5 A G 1: 36,428,016 (GRCm39) T437A probably benign Het
Gm10644 C A 8: 84,660,668 (GRCm39) probably benign Het
Katnb1 A G 8: 95,825,340 (GRCm39) S635G probably benign Het
Map3k12 A G 15: 102,412,670 (GRCm39) V234A possibly damaging Het
Mks1 A G 11: 87,747,696 (GRCm39) N193S probably benign Het
Mmp11 T C 10: 75,763,223 (GRCm39) E151G probably damaging Het
Napg A G 18: 63,127,440 (GRCm39) R265G possibly damaging Het
Odad2 T A 18: 7,268,507 (GRCm39) probably null Het
Or5e1 T A 7: 108,354,781 (GRCm39) C239* probably null Het
Or6e1 A G 14: 54,520,022 (GRCm39) F110S possibly damaging Het
P3r3urf T C 4: 116,030,812 (GRCm39) I72T probably damaging Het
Pcdha7 G T 18: 37,108,136 (GRCm39) C387F probably damaging Het
Pcdhb3 G T 18: 37,434,700 (GRCm39) R222L probably benign Het
Phf2 A G 13: 48,973,546 (GRCm39) M373T unknown Het
Plekha7 T C 7: 115,739,634 (GRCm39) T636A probably damaging Het
Rictor G A 15: 6,823,487 (GRCm39) E1555K probably benign Het
Rnf6 G A 5: 146,147,959 (GRCm39) P353L probably benign Het
Sel1l3 A C 5: 53,342,150 (GRCm39) L357V possibly damaging Het
Sh3rf3 T A 10: 58,819,975 (GRCm39) M262K possibly damaging Het
Sorcs3 A T 19: 48,776,950 (GRCm39) H994L probably damaging Het
Thsd7a A T 6: 12,503,922 (GRCm39) C411S probably damaging Het
Ttn T C 2: 76,593,682 (GRCm39) K20653E probably damaging Het
Ttn A C 2: 76,708,908 (GRCm39) probably null Het
Ttn A G 2: 76,611,264 (GRCm39) W15677R probably damaging Het
Ubr2 T C 17: 47,267,581 (GRCm39) M1049V possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACTGAGAGATCGGTCCC -3'
(R):5'- TTACCCTTGGGACACCGTTC -3'

Sequencing Primer
(F):5'- TGCCATGCAGTGCTGAC -3'
(R):5'- TTGGGACACCGTTCATGCC -3'
Posted On 2017-10-20