Incidental Mutation 'R5867:Mff'
ID490489
Institutional Source Beutler Lab
Gene Symbol Mff
Ensembl Gene ENSMUSG00000026150
Gene Namemitochondrial fission factor
Synonyms
MMRRC Submission 043233-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5867 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location82724890-82752394 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 82750606 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073025] [ENSMUST00000078332] [ENSMUST00000160744] [ENSMUST00000160786] [ENSMUST00000160972] [ENSMUST00000161648] [ENSMUST00000162003]
Predicted Effect probably null
Transcript: ENSMUST00000073025
SMART Domains Protein: ENSMUSP00000072784
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 239 6.6e-101 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078332
SMART Domains Protein: ENSMUSP00000077446
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 291 2.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160044
SMART Domains Protein: ENSMUSP00000125005
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 130 7.5e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160632
Predicted Effect probably null
Transcript: ENSMUST00000160744
SMART Domains Protein: ENSMUSP00000125629
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 137 2.6e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160750
SMART Domains Protein: ENSMUSP00000125223
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 155 6.2e-67 PFAM
Pfam:Miff 144 220 2.6e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160786
SMART Domains Protein: ENSMUSP00000125230
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 238 6e-101 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160972
SMART Domains Protein: ENSMUSP00000124200
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 152 8.1e-60 PFAM
Pfam:Miff 146 218 1.8e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161648
SMART Domains Protein: ENSMUSP00000124164
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 243 1.1e-102 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162003
SMART Domains Protein: ENSMUSP00000124334
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 316 8.1e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188333
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout reduces mitochondrial hyperfusion-induced apoptotic cell death of endothelial cells of cardiac microvessels after induced ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,052 V2900A probably damaging Het
Akip1 A G 7: 109,707,477 H127R probably benign Het
Alad A T 4: 62,512,966 Y56N probably damaging Het
Aldoart1 T A 4: 72,852,533 M13L probably benign Het
Ap1g1 C T 8: 109,818,982 A89V probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Cd209b T C 8: 3,924,246 I89V possibly damaging Het
Cd36 T C 5: 17,785,735 K469R probably benign Het
Cdh7 T A 1: 110,048,851 I82N probably damaging Het
Clmn G T 12: 104,781,755 P511H probably damaging Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Cyp2a5 T C 7: 26,842,958 F462L probably benign Het
Dclk2 A G 3: 86,791,859 *709Q probably null Het
Drd1 T C 13: 54,054,163 T4A probably benign Het
Ephb2 C T 4: 136,675,422 V513I possibly damaging Het
Fam43a T A 16: 30,601,459 V287E probably benign Het
Gm5134 A G 10: 76,008,616 E602G probably benign Het
Gtsf2 C T 15: 103,439,636 G149E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhl6 T C 16: 19,982,820 T62A probably benign Het
Lamb1 T A 12: 31,298,955 I662N possibly damaging Het
Lmod3 A G 6: 97,248,002 V286A probably damaging Het
Mefv T C 16: 3,715,933 D158G probably damaging Het
Mfsd6l G T 11: 68,557,210 V296L possibly damaging Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Olfr1033 A G 2: 86,041,451 I45M probably benign Het
Pdk4 T A 6: 5,487,452 H266L probably benign Het
Pdrg1 T C 2: 153,014,055 N40D probably damaging Het
Pi4k2a T C 19: 42,105,485 probably null Het
Pkd1l2 T A 8: 117,055,011 D765V probably damaging Het
Pspc1 A T 14: 56,762,041 probably null Het
Ptprm T C 17: 67,045,981 probably null Het
Spata31d1d T C 13: 59,727,240 K827R possibly damaging Het
Srebf2 T A 15: 82,169,786 F46Y probably damaging Het
Tfrc T A 16: 32,620,412 C365S possibly damaging Het
Ttc7 A G 17: 87,322,472 H294R possibly damaging Het
Ubr7 T A 12: 102,761,494 Y92N probably damaging Het
Vmn1r42 A C 6: 89,844,779 Y269* probably null Het
Vmn2r1 A G 3: 64,104,569 E617G probably benign Het
Vps13c A G 9: 67,982,622 probably null Het
Vps50 T C 6: 3,536,965 L312P probably damaging Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zcchc3 A G 2: 152,414,524 F85S probably damaging Het
Zfhx3 T C 8: 108,793,446 L400P probably damaging Het
Other mutations in Mff
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Mff APN 1 82741975 missense probably damaging 1.00
IGL02934:Mff APN 1 82747094 missense probably damaging 1.00
IGL03381:Mff APN 1 82741940 missense probably damaging 1.00
R0652:Mff UTSW 1 82750564 missense possibly damaging 0.91
R0755:Mff UTSW 1 82750605 critical splice donor site probably null
R1215:Mff UTSW 1 82741888 missense probably benign 0.45
R2074:Mff UTSW 1 82751700 missense probably damaging 1.00
R2078:Mff UTSW 1 82741921 missense probably damaging 1.00
R2365:Mff UTSW 1 82735471 missense possibly damaging 0.74
R4498:Mff UTSW 1 82741780 intron probably benign
R5099:Mff UTSW 1 82750471 intron probably benign
R5984:Mff UTSW 1 82731127 missense probably benign 0.00
R6723:Mff UTSW 1 82751666 missense possibly damaging 0.91
R7135:Mff UTSW 1 82747091 nonsense probably null
R7373:Mff UTSW 1 82737117 splice site probably null
R7475:Mff UTSW 1 82745438 splice site probably null
R7792:Mff UTSW 1 82747081 critical splice acceptor site probably null
R8088:Mff UTSW 1 82751649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGATAGTCATCTTAAGCTGCTTTTC -3'
(R):5'- TTGGTAGCAATGTTCTATGCTGATC -3'

Sequencing Primer
(F):5'- CATCTTAAGCTGCTTTTCCTTATTTG -3'
(R):5'- GCAATGTTCTATGCTGATCAAAATC -3'
Posted On2017-10-20