Incidental Mutation 'R0529:Vmn1r174'
ID49049
Institutional Source Beutler Lab
Gene Symbol Vmn1r174
Ensembl Gene ENSMUSG00000090411
Gene Namevomeronasal 1 receptor 174
SynonymsV1rd22
MMRRC Submission 038721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0529 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23752270-23762403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23754197 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 96 (R96H)
Ref Sequence ENSEMBL: ENSMUSP00000154506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167551] [ENSMUST00000228331]
Predicted Effect probably benign
Transcript: ENSMUST00000167551
AA Change: R96H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126478
Gene: ENSMUSG00000090411
AA Change: R96H

DomainStartEndE-ValueType
Pfam:TAS2R 8 300 4e-9 PFAM
Pfam:V1R 43 300 5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228331
AA Change: R96H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 8,992,396 V126I probably benign Het
Aasdh A C 5: 76,876,267 Y179* probably null Het
Afp A G 5: 90,504,395 Y415C probably damaging Het
Aldh5a1 G T 13: 24,913,873 T393K probably benign Het
Arhgef26 T C 3: 62,339,725 S77P probably benign Het
Axl A G 7: 25,787,287 probably benign Het
Card10 A G 15: 78,780,475 probably null Het
Ccdc71l G A 12: 32,379,252 S90N probably damaging Het
Cebpa A T 7: 35,120,199 T261S probably benign Het
Cnmd T C 14: 79,642,041 E219G probably benign Het
Cntln T A 4: 85,067,825 L1010H probably damaging Het
Cul9 A G 17: 46,520,468 probably benign Het
Cyld A G 8: 88,729,759 E479G probably benign Het
Dmp1 A G 5: 104,212,226 E256G probably benign Het
Dnmt1 T C 9: 20,911,550 D1140G probably damaging Het
Drd2 A C 9: 49,407,074 M439L probably benign Het
Drd3 G A 16: 43,822,714 V438M probably damaging Het
Dyrk3 A G 1: 131,130,121 I70T probably benign Het
Fam46c A G 3: 100,472,370 Y357H probably benign Het
Fbxo38 T C 18: 62,505,986 K1082E probably damaging Het
Fbxw10 A C 11: 62,859,845 D428A probably damaging Het
Fmn1 T A 2: 113,707,853 probably benign Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Gda T A 19: 21,425,537 I82F probably damaging Het
Gpatch4 T A 3: 88,051,276 H22Q probably damaging Het
Gpr55 A G 1: 85,941,503 F119L probably benign Het
Gtf2i A T 5: 134,261,869 L425* probably null Het
Knstrn T A 2: 118,830,980 probably benign Het
Lipo2 T A 19: 33,746,935 I144L probably benign Het
Lrp1 T C 10: 127,541,594 probably null Het
Mtmr14 T C 6: 113,266,252 probably benign Het
Nsmce4a A T 7: 130,533,806 S345R probably benign Het
Oacyl T A 18: 65,742,219 V385D probably damaging Het
Olfr421-ps1 G A 1: 174,152,130 A205T probably benign Het
Olfr917 A T 9: 38,665,512 C111S probably benign Het
Phlpp2 T C 8: 109,876,971 S55P probably benign Het
Pkhd1l1 T A 15: 44,526,754 V1422E possibly damaging Het
Plcd3 T G 11: 103,080,187 H181P probably benign Het
Psmc5 G A 11: 106,261,164 probably null Het
Psmd11 T C 11: 80,470,689 probably benign Het
Rab39 T C 9: 53,686,716 Y83C probably damaging Het
Ric8a A G 7: 140,860,893 E93G probably damaging Het
Rtp3 T C 9: 110,987,084 E133G possibly damaging Het
Serpina1e A C 12: 103,949,104 L281R probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tmem63a A T 1: 180,961,094 E332V probably benign Het
Tnk1 T C 11: 69,855,164 T312A probably damaging Het
Traf3ip3 G T 1: 193,194,811 probably benign Het
Trappc11 A G 8: 47,526,979 V174A possibly damaging Het
Vmn1r7 T A 6: 57,024,465 Y270F possibly damaging Het
Vmn2r12 A G 5: 109,092,848 V133A probably benign Het
Vmn2r18 T A 5: 151,562,523 E502V probably damaging Het
Wipf3 C A 6: 54,485,363 P186Q probably damaging Het
Yipf5 A T 18: 40,212,162 M55K probably benign Het
Zbtb7a G A 10: 81,143,986 V5M probably damaging Het
Zfy1 G T Y: 726,040 S575Y probably damaging Het
Other mutations in Vmn1r174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Vmn1r174 APN 7 23754533 missense possibly damaging 0.77
IGL00950:Vmn1r174 APN 7 23754486 missense possibly damaging 0.96
IGL01484:Vmn1r174 APN 7 23754324 nonsense probably null
IGL02014:Vmn1r174 APN 7 23754158 missense probably damaging 1.00
IGL02190:Vmn1r174 APN 7 23754827 missense unknown
IGL03265:Vmn1r174 APN 7 23754473 nonsense probably null
IGL03335:Vmn1r174 APN 7 23754512 missense probably benign 0.41
R1489:Vmn1r174 UTSW 7 23754556 nonsense probably null
R1645:Vmn1r174 UTSW 7 23754352 missense possibly damaging 0.87
R1691:Vmn1r174 UTSW 7 23753912 start codon destroyed probably null 1.00
R1753:Vmn1r174 UTSW 7 23754197 missense probably benign 0.00
R1939:Vmn1r174 UTSW 7 23754107 missense probably damaging 0.99
R1988:Vmn1r174 UTSW 7 23754625 missense probably damaging 0.98
R2299:Vmn1r174 UTSW 7 23754004 missense probably benign 0.08
R4429:Vmn1r174 UTSW 7 23754140 missense probably benign 0.02
R4516:Vmn1r174 UTSW 7 23754343 missense probably benign 0.01
R4589:Vmn1r174 UTSW 7 23754779 nonsense probably null
R5175:Vmn1r174 UTSW 7 23754728 missense probably benign 0.03
R5392:Vmn1r174 UTSW 7 23754802 missense unknown
R5503:Vmn1r174 UTSW 7 23754137 missense probably benign 0.03
R5568:Vmn1r174 UTSW 7 23754494 missense probably damaging 0.96
R6705:Vmn1r174 UTSW 7 23754426 missense probably benign 0.25
R8168:Vmn1r174 UTSW 7 23754671 missense probably damaging 0.99
R8190:Vmn1r174 UTSW 7 23754143 missense probably damaging 1.00
R8523:Vmn1r174 UTSW 7 23754757 missense probably damaging 1.00
R8555:Vmn1r174 UTSW 7 23754545 missense possibly damaging 0.84
X0011:Vmn1r174 UTSW 7 23754481 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTGCTGGCCCTCAACTGAGAC -3'
(R):5'- TGCTGATGAATATGGCATCGTGGAC -3'

Sequencing Primer
(F):5'- GAGACCAAAACATGTCATTCTTGC -3'
(R):5'- GAGTTAGAACATACCCACTTGCTG -3'
Posted On2013-06-12