Mutagenetix > Incidental Mutations

Incidental Mutation 'R5851:Myo1e'

490504

Institutional Source

Beutler Lab

Gene Symbol

Myo1e

Ensembl Gene

ENSMUSG00000032220

Gene Name

myosin IE

Synonyms

2310020N23Rik, 9130023P14Rik

MMRRC Submission

044067-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70207350-70399766 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70383804 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 959 (G959E)

Ref Sequence

ENSEMBL: ENSMUSP00000034745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]

PDB Structure

MYOSIN 1E SH3 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000034745
AA Change: G959E

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: G959E

Domain	Start	End	E-Value	Type
MYSc	13	693	N/A	SMART
Pfam:Myosin_TH1	719	917	1e-55	PFAM
SH3	1053	1107	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000214042

Meta Mutation Damage Score

0.0855

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930404N11Rik	A	T	10: 81,364,877		probably null	Het
Abca2	A	G	2: 25,442,310	N1452D	possibly damaging	Het
Abhd15	T	C	11: 77,518,447	L329P	probably benign	Het
Add3	T	C	19: 53,236,774	S442P	probably damaging	Het
Arhgef18	T	C	8: 3,434,980	F228L	probably damaging	Het
Bptf	A	T	11: 107,110,862	Y475N	probably damaging	Het
C3	T	C	17: 57,211,612	N1257S	probably null	Het
Ccdc94	C	T	17: 55,967,582	S298F	probably damaging	Het
Cd163l1	C	T	7: 140,228,027	P704S	possibly damaging	Het
Cdkl1	A	T	12: 69,756,564	Y179*	probably null	Het
Ceacam1	T	C	7: 25,474,600	N210S	possibly damaging	Het
Celf3	T	A	3: 94,479,126	I7N	probably damaging	Het
Cmpk1	A	G	4: 114,986,970	V55A	possibly damaging	Het
Csrnp1	C	T	9: 119,973,078	G305D	possibly damaging	Het
Dnah3	A	G	7: 120,039,362	S1266P	possibly damaging	Het
Edc4	T	C	8: 105,890,867	L1077P	probably damaging	Het
Efcab1	T	A	16: 14,920,436	L155H	probably damaging	Het
Fam174a	G	A	1: 95,325,143	G157S	probably damaging	Het
Fubp3	T	A	2: 31,598,610	D159E	probably benign	Het
Garem2	C	T	5: 30,114,290	T250M	probably damaging	Het
H2-Eb1	C	T	17: 34,309,771	P92L	probably benign	Het
Ifnl3	G	T	7: 28,523,511	C69F	probably damaging	Het
Itga2b	C	A	11: 102,457,601		probably benign	Het
Klhl33	A	T	14: 50,892,878	D386E	probably damaging	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lor	G	A	3: 92,080,539	A480V	unknown	Het
Msh3	G	T	13: 92,215,522	Q1041K	probably benign	Het
Nfat5	G	T	8: 107,347,727	V338L	probably damaging	Het
Nrf1	A	G	6: 30,089,976	H18R	possibly damaging	Het
Nup160	A	G	2: 90,707,038	D752G	probably benign	Het
Obscn	A	T	11: 58,994,700	L2489*	probably null	Het
Olfr1184	A	G	2: 88,486,860	I43V	possibly damaging	Het
Olfr638	A	G	7: 104,003,452	E59G	probably benign	Het
Paip1	T	C	13: 119,440,765	S215P	possibly damaging	Het
Pate2	T	A	9: 35,670,501	Y26*	probably null	Het
Pcdhb10	A	G	18: 37,412,758	I296V	probably benign	Het
Pdzph1	T	G	17: 58,973,746	T514P	probably benign	Het
Pnlip	G	A	19: 58,673,792	W123*	probably null	Het
Prmt2	C	A	10: 76,236,740	C9F	possibly damaging	Het
Rbl1	T	A	2: 157,167,325	K763N	probably benign	Het
Rfk	C	T	19: 17,395,198	A28V	probably damaging	Het
Sdk1	G	A	5: 141,962,669	V590I	probably benign	Het
Sele	A	G	1: 164,049,574	K140E	probably benign	Het
Skiv2l2	G	A	13: 112,908,952	R349W	probably damaging	Het
Sla	G	A	15: 66,783,723	T189I	probably damaging	Het
Slc46a2	A	G	4: 59,913,906	V339A	probably damaging	Het
Slc5a9	A	G	4: 111,885,600	F432L	probably benign	Het
Slc6a19	A	G	13: 73,691,740	F141S	possibly damaging	Het
Tas2r123	T	C	6: 132,847,308	L56S	probably damaging	Het
Tmem245	T	C	4: 56,916,770	I53V	probably benign	Het
Tor2a	A	T	2: 32,761,607	Q278L	probably benign	Het
Trav6-3	A	G	14: 53,430,115	M15V	probably benign	Het
Ttc28	G	A	5: 111,235,469		probably benign	Het
Ubap2	G	A	4: 41,206,268	Q534*	probably null	Het
Zfp954	C	A	7: 7,115,625	E307*	probably null	Het
Zscan21	A	G	5: 138,126,478	K219E	probably benign	Het

Other mutations in Myo1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00817:Myo1e	APN	9	70342148	missense	probably benign	0.01
IGL00833:Myo1e	APN	9	70338778	missense	probably damaging	0.99
IGL00973:Myo1e	APN	9	70338787	missense	probably damaging	1.00
IGL01011:Myo1e	APN	9	70316589	splice site	probably benign
IGL01401:Myo1e	APN	9	70327166	missense	probably damaging	0.97
IGL01402:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01404:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01613:Myo1e	APN	9	70341273	splice site	probably benign
IGL01738:Myo1e	APN	9	70359370	missense	probably damaging	1.00
IGL01819:Myo1e	APN	9	70343040	splice site	probably benign
IGL02233:Myo1e	APN	9	70383799	splice site	probably benign
IGL02244:Myo1e	APN	9	70367689	missense	probably benign	0.00
IGL02440:Myo1e	APN	9	70346740	missense	probably damaging	1.00
IGL02806:Myo1e	APN	9	70362270	missense	probably benign	0.01
IGL02886:Myo1e	APN	9	70368773	missense	probably benign	0.00
IGL03178:Myo1e	APN	9	70286949	missense	possibly damaging	0.47
I2288:Myo1e	UTSW	9	70342097	missense	possibly damaging	0.80
R0036:Myo1e	UTSW	9	70341308	missense	probably damaging	1.00
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0399:Myo1e	UTSW	9	70301793	splice site	probably benign
R0526:Myo1e	UTSW	9	70322398	missense	probably damaging	1.00
R0599:Myo1e	UTSW	9	70376660	splice site	probably benign
R0656:Myo1e	UTSW	9	70367674	missense	probably damaging	1.00
R1078:Myo1e	UTSW	9	70383999	missense	probably benign
R1278:Myo1e	UTSW	9	70398785	missense	probably damaging	1.00
R1300:Myo1e	UTSW	9	70301783	missense	probably damaging	1.00
R1329:Myo1e	UTSW	9	70338738	missense	possibly damaging	0.96
R1349:Myo1e	UTSW	9	70287069	splice site	probably benign
R1463:Myo1e	UTSW	9	70338756	missense	possibly damaging	0.88
R1656:Myo1e	UTSW	9	70395934	missense	probably damaging	1.00
R1727:Myo1e	UTSW	9	70376524	missense	possibly damaging	0.88
R1789:Myo1e	UTSW	9	70338784	missense	probably damaging	1.00
R1970:Myo1e	UTSW	9	70368773	missense	probably benign	0.00
R2029:Myo1e	UTSW	9	70368687	missense	possibly damaging	0.78
R2029:Myo1e	UTSW	9	70378715	splice site	probably benign
R2039:Myo1e	UTSW	9	70320133	missense	possibly damaging	0.89
R2076:Myo1e	UTSW	9	70383877	missense	probably benign
R2256:Myo1e	UTSW	9	70378373	splice site	probably null
R2257:Myo1e	UTSW	9	70378373	splice site	probably null
R2323:Myo1e	UTSW	9	70378758	nonsense	probably null
R2443:Myo1e	UTSW	9	70327172	missense	probably benign
R4023:Myo1e	UTSW	9	70324875	missense	probably benign
R4024:Myo1e	UTSW	9	70324875	missense	probably benign
R4025:Myo1e	UTSW	9	70324875	missense	probably benign
R4026:Myo1e	UTSW	9	70324875	missense	probably benign
R4151:Myo1e	UTSW	9	70297351	nonsense	probably null
R4764:Myo1e	UTSW	9	70343135	splice site	probably null
R4768:Myo1e	UTSW	9	70370469	missense	possibly damaging	0.63
R4911:Myo1e	UTSW	9	70343096	missense	probably benign
R4995:Myo1e	UTSW	9	70353272	missense	probably benign	0.01
R4999:Myo1e	UTSW	9	70353312	missense	probably damaging	1.00
R5228:Myo1e	UTSW	9	70322358	intron	probably null
R5414:Myo1e	UTSW	9	70322358	intron	probably null
R5577:Myo1e	UTSW	9	70370471	missense	probably benign	0.31
R6208:Myo1e	UTSW	9	70376605	missense	probably damaging	0.99
R6907:Myo1e	UTSW	9	70327155	missense	probably benign
R7084:Myo1e	UTSW	9	70337801	missense	probably damaging	0.96
R7313:Myo1e	UTSW	9	70359385	critical splice donor site	probably null
R7383:Myo1e	UTSW	9	70297295	missense	probably damaging	1.00
R7811:Myo1e	UTSW	9	70327262	missense	probably damaging	0.96
R8309:Myo1e	UTSW	9	70346763	missense	possibly damaging	0.90
X0021:Myo1e	UTSW	9	70378273	missense	probably damaging	0.99
X0065:Myo1e	UTSW	9	70378294	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GCTATTACGTTGTTGTCCCCAAG -3'
(R):5'- GGACCTTGAGGAAATCCAGG -3'

Sequencing Primer
(F):5'- AACAGTTATACCTCAGTAGTGTTGGG -3'
(R):5'- CTTGAGGAAATCCAGGCTCTCTG -3'

Posted On

2017-10-20