Incidental Mutation 'R5854:Gmcl1'
ID490507
Institutional Source Beutler Lab
Gene Symbol Gmcl1
Ensembl Gene ENSMUSG00000001157
Gene Namegerm cell-less, spermatogenesis associated 1
SynonymsGcl, mglc-1, 2810049L19Rik
MMRRC Submission 043228-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R5854 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86691768-86733383 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 86714259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001185]
Predicted Effect silent
Transcript: ENSMUST00000001185
SMART Domains Protein: ENSMUSP00000001185
Gene: ENSMUSG00000001157

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
BTB 106 206 3.76e-11 SMART
BACK 211 298 3.6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203741
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear envelope protein that appears to be involved in spermatogenesis, either directly or by influencing genes that play a more direct role in the process. This multi-exon locus is the homolog of the mouse and drosophila germ cell-less gene but the human genome also contains a single-exon locus on chromosome 5 that contains an open reading frame capable of encoding a highly-related protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired nuclear membrane integrity in liver, endocrine pancreas, and testis. Mutant males show reduced fertility with decreased chromatin condensation and morphologically abnormal sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Atg4c G A 4: 99,228,559 V313I probably benign Het
Ccdc18 A G 5: 108,206,728 E1111G possibly damaging Het
Chuk T C 19: 44,081,957 H573R probably benign Het
Cst13 A G 2: 148,828,174 N88S probably benign Het
Dalrd3 T C 9: 108,570,077 probably null Het
Dnah8 T A 17: 30,794,763 M3826K possibly damaging Het
Dsp A G 13: 38,167,501 probably null Het
Fbxo41 A G 6: 85,475,094 L810P probably damaging Het
Fcrlb T C 1: 170,907,961 Y248C probably damaging Het
Gtf3c3 C A 1: 54,419,437 A442S probably benign Het
Hdac4 T C 1: 91,959,421 S799G probably damaging Het
Hnrnpa2b1 C G 6: 51,466,609 probably benign Het
Hnrnpab T C 11: 51,604,681 E177G probably damaging Het
Knl1 A G 2: 119,070,403 I862V probably benign Het
Lonp2 T A 8: 86,673,071 probably null Het
Map3k19 G T 1: 127,830,355 P363T probably damaging Het
Morn3 A G 5: 123,041,115 Y91H probably damaging Het
Myom2 A G 8: 15,108,478 D810G probably benign Het
Nans A G 4: 46,500,180 Y188C probably damaging Het
Ndufs1 A T 1: 63,147,389 D1E probably benign Het
Nelfb T C 2: 25,209,993 N204S probably damaging Het
Noxo1 T C 17: 24,698,542 S31P probably damaging Het
Olfr312 T A 11: 58,831,556 M134K probably damaging Het
Olfr53 A G 7: 140,652,578 M200V probably benign Het
Olfr914 T C 9: 38,606,663 L66S probably damaging Het
Pkd1l2 T G 8: 117,065,746 T436P possibly damaging Het
Pkhd1l1 A G 15: 44,581,790 D3686G probably damaging Het
Ppp2r5b A G 19: 6,230,944 L285S probably damaging Het
Pzp A T 6: 128,506,869 V522D probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rpe65 A G 3: 159,615,676 D375G probably benign Het
Sacs C T 14: 61,211,547 L3681F probably damaging Het
Sft2d1 C T 17: 8,320,653 T96I probably damaging Het
Slc12a7 A G 13: 73,793,940 N312D probably benign Het
Spaca6 A T 17: 17,831,247 K82* probably null Het
Stk32c A G 7: 139,188,279 probably benign Het
Tet2 T A 3: 133,487,885 N263Y probably damaging Het
Uxs1 T C 1: 43,780,073 N190S probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gmcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Gmcl1 APN 6 86707457 missense possibly damaging 0.52
IGL03354:Gmcl1 APN 6 86726158 missense probably damaging 1.00
PIT4453001:Gmcl1 UTSW 6 86704538 missense probably benign 0.09
R0149:Gmcl1 UTSW 6 86732909 critical splice donor site probably null
R1398:Gmcl1 UTSW 6 86714262 splice site probably benign
R1869:Gmcl1 UTSW 6 86697516 missense probably benign 0.20
R1871:Gmcl1 UTSW 6 86697516 missense probably benign 0.20
R2851:Gmcl1 UTSW 6 86726177 missense probably damaging 0.99
R4584:Gmcl1 UTSW 6 86722623 missense probably damaging 1.00
R4585:Gmcl1 UTSW 6 86722623 missense probably damaging 1.00
R4664:Gmcl1 UTSW 6 86732998 missense probably benign 0.30
R4851:Gmcl1 UTSW 6 86704556 missense possibly damaging 0.64
R4957:Gmcl1 UTSW 6 86710521 missense probably damaging 1.00
R5326:Gmcl1 UTSW 6 86726145 missense possibly damaging 0.96
R5482:Gmcl1 UTSW 6 86718073 missense probably damaging 1.00
R5496:Gmcl1 UTSW 6 86697525 missense probably damaging 0.97
R5817:Gmcl1 UTSW 6 86714248 missense probably damaging 1.00
R5891:Gmcl1 UTSW 6 86707443 missense probably damaging 1.00
R5895:Gmcl1 UTSW 6 86711614 missense probably benign 0.03
R6012:Gmcl1 UTSW 6 86721412 missense probably damaging 1.00
R6257:Gmcl1 UTSW 6 86700641 missense possibly damaging 0.82
R7693:Gmcl1 UTSW 6 86714257 missense probably benign 0.10
R7698:Gmcl1 UTSW 6 86707415 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCAGCTTTTCACCACAGAAG -3'
(R):5'- TGCAGTGTTAGCTAGCTCAG -3'

Sequencing Primer
(F):5'- GCTTTTCACCACAGAAGCAATGTG -3'
(R):5'- TAAATTCAAGCCCTAGACCTGTGGG -3'
Posted On2017-10-20