Incidental Mutation 'R5876:Asap2'
ID490530
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms6530401G17Rik, LOC385250, Ddef2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location20990459-21270171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21212809 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 229 (N229K)
Ref Sequence ENSEMBL: ENSMUSP00000063217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]
Predicted Effect probably benign
Transcript: ENSMUST00000050990
AA Change: N229K

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: N229K

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000064595
AA Change: N229K

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: N229K

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090834
AA Change: N229K

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: N229K

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101562
AA Change: N229K

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: N229K

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21239648 missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21206316 missense probably damaging 1.00
IGL01285:Asap2 APN 12 21229263 missense probably damaging 1.00
IGL01318:Asap2 APN 12 21247295 missense probably null 0.00
IGL01355:Asap2 APN 12 21218086 splice site probably benign
IGL01593:Asap2 APN 12 21213202 missense probably null 0.03
IGL01705:Asap2 APN 12 21249368 missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21254306 missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21265910 missense probably damaging 1.00
IGL02876:Asap2 APN 12 21258163 missense probably benign 0.00
IGL02991:Asap2 APN 12 21249293 splice site probably benign
R0157:Asap2 UTSW 12 21206325 missense probably damaging 1.00
R0399:Asap2 UTSW 12 21217997 missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21213185 missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21247319 missense probably damaging 1.00
R0981:Asap2 UTSW 12 21265960 missense probably damaging 0.98
R1141:Asap2 UTSW 12 21185110 missense probably damaging 1.00
R1382:Asap2 UTSW 12 21265954 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239585 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239589 missense probably damaging 1.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1526:Asap2 UTSW 12 21185187 missense probably damaging 1.00
R1542:Asap2 UTSW 12 21265997 missense probably damaging 1.00
R1710:Asap2 UTSW 12 21224392 missense probably damaging 1.00
R1750:Asap2 UTSW 12 21203998 missense probably damaging 1.00
R2151:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2152:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2154:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2323:Asap2 UTSW 12 21203968 missense probably damaging 1.00
R2378:Asap2 UTSW 12 21254318 missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21224377 missense probably damaging 1.00
R3757:Asap2 UTSW 12 21267766 missense probably damaging 1.00
R4305:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4307:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4308:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4345:Asap2 UTSW 12 21230831 missense probably damaging 1.00
R4525:Asap2 UTSW 12 21229292 splice site probably null
R4562:Asap2 UTSW 12 21112093 missense probably damaging 1.00
R4999:Asap2 UTSW 12 21252765 missense probably benign 0.19
R5027:Asap2 UTSW 12 21204081 missense probably damaging 1.00
R5221:Asap2 UTSW 12 21213190 missense probably benign 0.14
R5645:Asap2 UTSW 12 21265982 missense probably damaging 0.99
R5799:Asap2 UTSW 12 21168246 missense probably damaging 1.00
R5888:Asap2 UTSW 12 21218190 missense probably damaging 1.00
R5912:Asap2 UTSW 12 21206343 missense probably damaging 1.00
R6576:Asap2 UTSW 12 21244703 missense probably damaging 1.00
R6896:Asap2 UTSW 12 21265525 missense probably damaging 1.00
R6934:Asap2 UTSW 12 21168250 missense probably damaging 1.00
R7134:Asap2 UTSW 12 21265963 nonsense probably null
R7347:Asap2 UTSW 12 21229457 missense probably benign 0.03
R7378:Asap2 UTSW 12 21112051 missense probably benign 0.01
R7515:Asap2 UTSW 12 21229239 missense possibly damaging 0.76
R8033:Asap2 UTSW 12 21224389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGGAGAGTCTGGTTTCC -3'
(R):5'- GTTTCCAGACAGCACAGCATG -3'

Sequencing Primer
(F):5'- CACAAATGCTCAGGCTTATAATTCG -3'
(R):5'- CACAGCATGCATACAGGAGGTTATAG -3'
Posted On2017-10-20