Incidental Mutation 'R5878:Mctp2'
ID490535
Institutional Source Beutler Lab
Gene Symbol Mctp2
Ensembl Gene ENSMUSG00000032776
Gene Namemultiple C2 domains, transmembrane 2
SynonymsLOC244049
MMRRC Submission 044084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5878 (G1)
Quality Score216
Status Validated
Chromosome7
Chromosomal Location72077830-72306608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72214108 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 336 (S336P)
Ref Sequence ENSEMBL: ENSMUSP00000078302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079323]
Predicted Effect probably benign
Transcript: ENSMUST00000079323
AA Change: S336P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776
AA Change: S336P

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
C2 195 291 7.5e-20 SMART
C2 357 451 1.27e-8 SMART
C2 510 606 5.38e-21 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:PRT_C 723 857 2.4e-11 PFAM
Meta Mutation Damage Score 0.1119 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,960 S387T probably benign Het
Abca12 A T 1: 71,346,633 N275K possibly damaging Het
Abhd6 G A 14: 8,028,286 V6I probably benign Het
Afap1l2 T C 19: 56,915,675 T727A probably benign Het
Aggf1 T C 13: 95,369,557 E174G probably benign Het
Ahnak T G 19: 9,008,342 L2330R probably damaging Het
Arfgef2 A G 2: 166,870,217 T1205A probably benign Het
Ccdc3 T C 2: 5,229,016 L217P probably benign Het
Cfap54 T C 10: 92,964,561 D1595G probably benign Het
Cps1 G T 1: 67,157,878 probably null Het
Fam120b A G 17: 15,402,240 D160G probably damaging Het
Fam172a T A 13: 77,952,067 V129E probably damaging Het
Fezf1 C A 6: 23,247,581 R165L possibly damaging Het
Fkbp15 A T 4: 62,306,908 L838H probably benign Het
Frmd3 G A 4: 74,153,610 G243D probably damaging Het
Gldc A T 19: 30,143,467 probably null Het
Gm10188 T C 1: 132,229,202 probably benign Het
Gm5190 T A 12: 113,397,239 noncoding transcript Het
Gria1 T C 11: 57,317,802 probably null Het
Hdhd5 A G 6: 120,514,524 L206P probably damaging Het
Herc2 A G 7: 56,124,248 N1149S probably benign Het
Inca1 G A 11: 70,695,982 probably benign Het
Iqch G A 9: 63,547,990 S175F probably damaging Het
Itpr3 T G 17: 27,110,862 D1543E probably benign Het
Khk T A 5: 30,930,875 probably null Het
Kiz C T 2: 146,889,601 S337L probably damaging Het
Lzts3 G A 2: 130,636,539 T213I probably damaging Het
Mab21l2 T A 3: 86,546,718 D325V probably damaging Het
Me3 T A 7: 89,848,006 L405Q probably benign Het
Mgst2 A T 3: 51,661,230 probably benign Het
Myh2 A G 11: 67,192,504 E1431G probably damaging Het
Naip6 A G 13: 100,299,673 S781P probably damaging Het
Nr3c2 A G 8: 76,908,268 probably null Het
Olfr509 A T 7: 108,645,739 L279Q probably damaging Het
Olfr750 A G 14: 51,070,992 Y134H probably damaging Het
Olfr986 C T 9: 40,187,571 T152I probably benign Het
Otop1 G T 5: 38,277,822 R132L possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pcdhga4 G T 18: 37,687,686 G763W probably benign Het
Pde10a A G 17: 8,949,372 N9S possibly damaging Het
Pi4k2a T C 19: 42,100,641 I147T probably benign Het
Polh T A 17: 46,194,325 T122S probably damaging Het
Ptpn13 T C 5: 103,477,118 V96A possibly damaging Het
Ptpn6 C A 6: 124,728,785 C132F probably damaging Het
Rbm19 T A 5: 120,132,867 V585E probably damaging Het
Rp1l1 C T 14: 64,028,906 P647L probably benign Het
Rrp1b A G 17: 32,047,675 E72G probably damaging Het
Shcbp1 A T 8: 4,748,742 H392Q probably benign Het
Skiv2l C T 17: 34,846,117 R371Q possibly damaging Het
Slc13a5 G A 11: 72,253,391 T287I possibly damaging Het
Slc22a27 T A 19: 7,926,757 E5V probably benign Het
Slc38a2 A G 15: 96,692,584 V293A probably damaging Het
Slco6d1 T A 1: 98,463,836 probably benign Het
Sri G C 5: 8,059,353 D46H probably damaging Het
Tango6 A G 8: 106,689,168 D207G possibly damaging Het
Tigd4 T C 3: 84,594,442 M222T probably benign Het
Tmem229a T C 6: 24,955,173 D194G probably benign Het
Trank1 T C 9: 111,366,685 V1259A possibly damaging Het
Trdv5 T C 14: 54,148,798 D70G probably benign Het
Trim52 T A 14: 106,106,941 M11K probably damaging Het
Wdr62 A G 7: 30,241,347 M882T probably benign Het
Ybx3 A G 6: 131,367,763 probably null Het
Zfand2b A G 1: 75,170,510 probably benign Het
Zfp91 T A 19: 12,770,320 T480S possibly damaging Het
Other mutations in Mctp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mctp2 APN 7 72185815 missense probably damaging 0.96
IGL01296:Mctp2 APN 7 72228526 missense probably benign 0.03
IGL01509:Mctp2 APN 7 72259269 missense probably benign 0.01
IGL02074:Mctp2 APN 7 72161258 missense probably damaging 0.99
IGL02185:Mctp2 APN 7 72080823 missense probably benign 0.13
IGL02238:Mctp2 APN 7 72090205 nonsense probably null
IGL02707:Mctp2 APN 7 72259341 missense possibly damaging 0.95
IGL02820:Mctp2 APN 7 72245542 missense probably damaging 0.99
IGL02869:Mctp2 APN 7 72228471 critical splice donor site probably null
IGL03354:Mctp2 APN 7 72161244 missense probably benign 0.00
IGL03397:Mctp2 APN 7 72259277 missense probably damaging 0.98
IGL03407:Mctp2 APN 7 72211652 missense probably benign 0.05
F5770:Mctp2 UTSW 7 72121751 splice site probably benign
PIT4131001:Mctp2 UTSW 7 72090257 missense probably damaging 1.00
R0013:Mctp2 UTSW 7 72229408 missense probably benign 0.00
R0079:Mctp2 UTSW 7 72214116 splice site probably benign
R0083:Mctp2 UTSW 7 72228516 missense possibly damaging 0.94
R0173:Mctp2 UTSW 7 72247107 critical splice donor site probably null
R0302:Mctp2 UTSW 7 72090264 missense possibly damaging 0.94
R0533:Mctp2 UTSW 7 72080822 missense probably benign 0.00
R0675:Mctp2 UTSW 7 72083170 missense probably damaging 1.00
R1076:Mctp2 UTSW 7 72185867 critical splice acceptor site probably null
R1222:Mctp2 UTSW 7 72259139 missense probably benign
R1356:Mctp2 UTSW 7 72164723 unclassified probably benign
R1628:Mctp2 UTSW 7 72211589 splice site probably null
R1649:Mctp2 UTSW 7 72161258 missense probably damaging 0.99
R1981:Mctp2 UTSW 7 72164698 missense probably benign 0.01
R2256:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2257:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2327:Mctp2 UTSW 7 72211610 missense probably damaging 0.99
R2407:Mctp2 UTSW 7 72200407 missense probably benign 0.40
R2471:Mctp2 UTSW 7 72161161 nonsense probably null
R3706:Mctp2 UTSW 7 72214111 splice site probably benign
R4023:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4025:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4176:Mctp2 UTSW 7 72259337 missense probably benign
R4272:Mctp2 UTSW 7 72259331 missense possibly damaging 0.63
R4498:Mctp2 UTSW 7 72183851 missense probably damaging 1.00
R4654:Mctp2 UTSW 7 72090194 missense probably damaging 1.00
R4815:Mctp2 UTSW 7 72259349 missense possibly damaging 0.89
R4946:Mctp2 UTSW 7 72259269 missense probably benign 0.00
R5389:Mctp2 UTSW 7 72214087 missense possibly damaging 0.50
R5682:Mctp2 UTSW 7 72245459 critical splice donor site probably null
R5918:Mctp2 UTSW 7 72228540 missense probably damaging 1.00
R5956:Mctp2 UTSW 7 72259175 missense probably benign
R5964:Mctp2 UTSW 7 72103177 missense probably damaging 0.97
R5978:Mctp2 UTSW 7 72090188 missense probably damaging 1.00
R6054:Mctp2 UTSW 7 72259103 missense probably benign
R6475:Mctp2 UTSW 7 72200344 critical splice donor site probably null
R6849:Mctp2 UTSW 7 72211718 missense probably damaging 1.00
R6963:Mctp2 UTSW 7 72228056 missense probably damaging 1.00
R7366:Mctp2 UTSW 7 72259214 missense probably benign 0.00
R7468:Mctp2 UTSW 7 72211690 missense probably damaging 1.00
R7746:Mctp2 UTSW 7 72185796 missense probably benign
R7822:Mctp2 UTSW 7 72127187 missense possibly damaging 0.90
X0066:Mctp2 UTSW 7 72259280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGAACTTACCTTGCTTTTGTACC -3'
(R):5'- ACAGTGGAAGCAACTTGCAG -3'

Sequencing Primer
(F):5'- GTACCTCTGCTCTCCCAGTTTTAAC -3'
(R):5'- CTTGCAGAACGGGGAGC -3'
Posted On2017-10-20