Mutagenetix > Incidental Mutations

Incidental Mutation 'R5878:Nr3c2'

490536

Institutional Source

Beutler Lab

Gene Symbol

Nr3c2

Ensembl Gene

ENSMUSG00000031618

Gene Name

nuclear receptor subfamily 3, group C, member 2

Synonyms

MR, aldosterone receptor, mineralocorticoid receptor, Mlr

MMRRC Submission

044084-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5878 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76899442-77245012 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 76908268 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122959 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]

Predicted Effect

probably benign
Transcript: ENSMUST00000034031

SMART Domains

Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	675	1.89e-31	SMART
low complexity region	690	706	N/A	INTRINSIC
HOLI	771	935	7.78e-33	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109911

SMART Domains

Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
HOLI	658	818	1.1e-23	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109912

SMART Domains

Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
low complexity region	686	702	N/A	INTRINSIC
HOLI	767	931	7.78e-33	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109913

SMART Domains

Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
low complexity region	686	702	N/A	INTRINSIC
HOLI	767	931	7.78e-33	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000128862

Predicted Effect

probably null
Transcript: ENSMUST00000143284

Predicted Effect

probably benign
Transcript: ENSMUST00000148106

SMART Domains

Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,960	S387T	probably benign	Het
Abca12	A	T	1: 71,346,633	N275K	possibly damaging	Het
Abhd6	G	A	14: 8,028,286	V6I	probably benign	Het
Afap1l2	T	C	19: 56,915,675	T727A	probably benign	Het
Aggf1	T	C	13: 95,369,557	E174G	probably benign	Het
Ahnak	T	G	19: 9,008,342	L2330R	probably damaging	Het
Arfgef2	A	G	2: 166,870,217	T1205A	probably benign	Het
Ccdc3	T	C	2: 5,229,016	L217P	probably benign	Het
Cfap54	T	C	10: 92,964,561	D1595G	probably benign	Het
Cps1	G	T	1: 67,157,878		probably null	Het
Fam120b	A	G	17: 15,402,240	D160G	probably damaging	Het
Fam172a	T	A	13: 77,952,067	V129E	probably damaging	Het
Fezf1	C	A	6: 23,247,581	R165L	possibly damaging	Het
Fkbp15	A	T	4: 62,306,908	L838H	probably benign	Het
Frmd3	G	A	4: 74,153,610	G243D	probably damaging	Het
Gldc	A	T	19: 30,143,467		probably null	Het
Gm10188	T	C	1: 132,229,202		probably benign	Het
Gm5190	T	A	12: 113,397,239		noncoding transcript	Het
Gria1	T	C	11: 57,317,802		probably null	Het
Hdhd5	A	G	6: 120,514,524	L206P	probably damaging	Het
Herc2	A	G	7: 56,124,248	N1149S	probably benign	Het
Inca1	G	A	11: 70,695,982		probably benign	Het
Iqch	G	A	9: 63,547,990	S175F	probably damaging	Het
Itpr3	T	G	17: 27,110,862	D1543E	probably benign	Het
Khk	T	A	5: 30,930,875		probably null	Het
Kiz	C	T	2: 146,889,601	S337L	probably damaging	Het
Lzts3	G	A	2: 130,636,539	T213I	probably damaging	Het
Mab21l2	T	A	3: 86,546,718	D325V	probably damaging	Het
Mctp2	A	G	7: 72,214,108	S336P	probably benign	Het
Me3	T	A	7: 89,848,006	L405Q	probably benign	Het
Mgst2	A	T	3: 51,661,230		probably benign	Het
Myh2	A	G	11: 67,192,504	E1431G	probably damaging	Het
Naip6	A	G	13: 100,299,673	S781P	probably damaging	Het
Olfr509	A	T	7: 108,645,739	L279Q	probably damaging	Het
Olfr750	A	G	14: 51,070,992	Y134H	probably damaging	Het
Olfr986	C	T	9: 40,187,571	T152I	probably benign	Het
Otop1	G	T	5: 38,277,822	R132L	possibly damaging	Het
Parg	T	A	14: 32,217,662	D548E	possibly damaging	Het
Pcdhga4	G	T	18: 37,687,686	G763W	probably benign	Het
Pde10a	A	G	17: 8,949,372	N9S	possibly damaging	Het
Pi4k2a	T	C	19: 42,100,641	I147T	probably benign	Het
Polh	T	A	17: 46,194,325	T122S	probably damaging	Het
Ptpn13	T	C	5: 103,477,118	V96A	possibly damaging	Het
Ptpn6	C	A	6: 124,728,785	C132F	probably damaging	Het
Rbm19	T	A	5: 120,132,867	V585E	probably damaging	Het
Rp1l1	C	T	14: 64,028,906	P647L	probably benign	Het
Rrp1b	A	G	17: 32,047,675	E72G	probably damaging	Het
Shcbp1	A	T	8: 4,748,742	H392Q	probably benign	Het
Skiv2l	C	T	17: 34,846,117	R371Q	possibly damaging	Het
Slc13a5	G	A	11: 72,253,391	T287I	possibly damaging	Het
Slc22a27	T	A	19: 7,926,757	E5V	probably benign	Het
Slc38a2	A	G	15: 96,692,584	V293A	probably damaging	Het
Slco6d1	T	A	1: 98,463,836		probably benign	Het
Sri	G	C	5: 8,059,353	D46H	probably damaging	Het
Tango6	A	G	8: 106,689,168	D207G	possibly damaging	Het
Tigd4	T	C	3: 84,594,442	M222T	probably benign	Het
Tmem229a	T	C	6: 24,955,173	D194G	probably benign	Het
Trank1	T	C	9: 111,366,685	V1259A	possibly damaging	Het
Trdv5	T	C	14: 54,148,798	D70G	probably benign	Het
Trim52	T	A	14: 106,106,941	M11K	probably damaging	Het
Wdr62	A	G	7: 30,241,347	M882T	probably benign	Het
Ybx3	A	G	6: 131,367,763		probably null	Het
Zfand2b	A	G	1: 75,170,510		probably benign	Het
Zfp91	T	A	19: 12,770,320	T480S	possibly damaging	Het

Other mutations in Nr3c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00691:Nr3c2	APN	8	76909590	missense	possibly damaging	0.82
IGL01019:Nr3c2	APN	8	76909214	missense	probably damaging	0.99
IGL01085:Nr3c2	APN	8	76908354	missense	probably benign	0.02
IGL01395:Nr3c2	APN	8	76908848	missense	possibly damaging	0.73
IGL01505:Nr3c2	APN	8	76909187	missense	probably damaging	1.00
IGL01656:Nr3c2	APN	8	77187537	missense	probably damaging	1.00
IGL01802:Nr3c2	APN	8	76908595	nonsense	probably null
IGL02147:Nr3c2	APN	8	76909067	missense	probably damaging	0.98
IGL02502:Nr3c2	APN	8	77242514	missense	probably damaging	1.00
IGL02706:Nr3c2	APN	8	76908416	splice site	probably null
IGL02945:Nr3c2	APN	8	76909659	missense	probably damaging	1.00
IGL03034:Nr3c2	APN	8	77187638	nonsense	probably null
IGL03162:Nr3c2	APN	8	77217584	missense	probably damaging	0.99
naughty	UTSW	8	76908668	splice site	probably null
R0141:Nr3c2	UTSW	8	76908408	missense	probably damaging	0.99
R0422:Nr3c2	UTSW	8	77185967	missense	probably benign
R0458:Nr3c2	UTSW	8	76909538	missense	probably damaging	1.00
R0595:Nr3c2	UTSW	8	76909604	missense	possibly damaging	0.93
R0615:Nr3c2	UTSW	8	77185889	missense	probably benign	0.05
R0964:Nr3c2	UTSW	8	76908668	splice site	probably null
R0989:Nr3c2	UTSW	8	77187564	missense	probably damaging	0.97
R1532:Nr3c2	UTSW	8	76909104	missense	probably damaging	0.99
R1624:Nr3c2	UTSW	8	76909944	missense	probably damaging	1.00
R1737:Nr3c2	UTSW	8	76908329	missense	probably benign	0.16
R1965:Nr3c2	UTSW	8	76909463	missense	probably damaging	0.99
R2011:Nr3c2	UTSW	8	76909793	missense	possibly damaging	0.53
R2110:Nr3c2	UTSW	8	76908527	missense	possibly damaging	0.75
R2281:Nr3c2	UTSW	8	76909907	missense	probably damaging	0.99
R3782:Nr3c2	UTSW	8	77085684	splice site	probably null
R3808:Nr3c2	UTSW	8	76908714	missense	probably damaging	1.00
R4133:Nr3c2	UTSW	8	76909749	missense	probably damaging	1.00
R4433:Nr3c2	UTSW	8	77217467	missense	probably damaging	1.00
R4738:Nr3c2	UTSW	8	76909307	missense	possibly damaging	0.94
R4770:Nr3c2	UTSW	8	76908243	splice site	probably null
R4884:Nr3c2	UTSW	8	76908809	missense	possibly damaging	0.53
R5169:Nr3c2	UTSW	8	76909037	missense	probably damaging	1.00
R5347:Nr3c2	UTSW	8	77210748	missense	possibly damaging	0.92
R5857:Nr3c2	UTSW	8	76908867	missense	possibly damaging	0.53
R6262:Nr3c2	UTSW	8	76908633	missense	possibly damaging	0.65
R6547:Nr3c2	UTSW	8	76908809	missense	possibly damaging	0.53
R6820:Nr3c2	UTSW	8	77242457	missense	probably damaging	0.98
R7180:Nr3c2	UTSW	8	76908963	missense	probably damaging	0.99
R7672:Nr3c2	UTSW	8	76909209	missense	probably damaging	1.00
R7741:Nr3c2	UTSW	8	77210646	missense	probably damaging	0.97
R7776:Nr3c2	UTSW	8	76909545	missense	possibly damaging	0.77
R7800:Nr3c2	UTSW	8	76909992	missense	probably damaging	1.00
Z1088:Nr3c2	UTSW	8	76908632	missense	possibly damaging	0.48
Z1176:Nr3c2	UTSW	8	76909700	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GCCAAGGCCCTATTATAGTGAG -3'
(R):5'- ACTGTTGTTCGGAGTAGCAC -3'

Sequencing Primer
(F):5'- CACAAAATTGCAATTGGTTCTTCTGG -3'
(R):5'- CGGAGTAGCACCGGAAAC -3'

Posted On

2017-10-20