Incidental Mutation 'R5878:Aggf1'
ID490537
Institutional Source Beutler Lab
Gene Symbol Aggf1
Ensembl Gene ENSMUSG00000021681
Gene Nameangiogenic factor with G patch and FHA domains 1
Synonyms2010009L17Rik, 2310029P06Rik, VG5Q
MMRRC Submission 044084-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R5878 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95350683-95375352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95369557 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 174 (E174G)
Ref Sequence ENSEMBL: ENSMUSP00000022189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022189]
Predicted Effect probably benign
Transcript: ENSMUST00000022189
AA Change: E174G

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022189
Gene: ENSMUSG00000021681
AA Change: E174G

DomainStartEndE-ValueType
coiled coil region 20 85 N/A INTRINSIC
low complexity region 128 137 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
internal_repeat_1 205 225 4.68e-9 PROSPERO
internal_repeat_1 221 241 4.68e-9 PROSPERO
low complexity region 270 280 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 380 401 N/A INTRINSIC
FHA 430 484 1.51e-9 SMART
low complexity region 548 561 N/A INTRINSIC
G_patch 614 660 1.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161671
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor that promotes proliferation of endothelial cells. Mutations in this gene are associated with a susceptibility to Klippel-Trenaunay syndrome. Pseudogenes of this gene are found on chromosomes 3, 4, 10 and 16.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null embryos die before E8.5. Heterozygotes exhibit defective angiogenesis in yolk sacs and embryos and partial lethality. Surviving adults show hemorrhages, increased vascular permeability, and reduced tumor growth of implanted melanoma cell lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,960 S387T probably benign Het
Abca12 A T 1: 71,346,633 N275K possibly damaging Het
Abhd6 G A 14: 8,028,286 V6I probably benign Het
Afap1l2 T C 19: 56,915,675 T727A probably benign Het
Ahnak T G 19: 9,008,342 L2330R probably damaging Het
Arfgef2 A G 2: 166,870,217 T1205A probably benign Het
Ccdc3 T C 2: 5,229,016 L217P probably benign Het
Cfap54 T C 10: 92,964,561 D1595G probably benign Het
Cps1 G T 1: 67,157,878 probably null Het
Fam120b A G 17: 15,402,240 D160G probably damaging Het
Fam172a T A 13: 77,952,067 V129E probably damaging Het
Fezf1 C A 6: 23,247,581 R165L possibly damaging Het
Fkbp15 A T 4: 62,306,908 L838H probably benign Het
Frmd3 G A 4: 74,153,610 G243D probably damaging Het
Gldc A T 19: 30,143,467 probably null Het
Gm10188 T C 1: 132,229,202 probably benign Het
Gm5190 T A 12: 113,397,239 noncoding transcript Het
Gria1 T C 11: 57,317,802 probably null Het
Hdhd5 A G 6: 120,514,524 L206P probably damaging Het
Herc2 A G 7: 56,124,248 N1149S probably benign Het
Inca1 G A 11: 70,695,982 probably benign Het
Iqch G A 9: 63,547,990 S175F probably damaging Het
Itpr3 T G 17: 27,110,862 D1543E probably benign Het
Khk T A 5: 30,930,875 probably null Het
Kiz C T 2: 146,889,601 S337L probably damaging Het
Lzts3 G A 2: 130,636,539 T213I probably damaging Het
Mab21l2 T A 3: 86,546,718 D325V probably damaging Het
Mctp2 A G 7: 72,214,108 S336P probably benign Het
Me3 T A 7: 89,848,006 L405Q probably benign Het
Mgst2 A T 3: 51,661,230 probably benign Het
Myh2 A G 11: 67,192,504 E1431G probably damaging Het
Naip6 A G 13: 100,299,673 S781P probably damaging Het
Nr3c2 A G 8: 76,908,268 probably null Het
Olfr509 A T 7: 108,645,739 L279Q probably damaging Het
Olfr750 A G 14: 51,070,992 Y134H probably damaging Het
Olfr986 C T 9: 40,187,571 T152I probably benign Het
Otop1 G T 5: 38,277,822 R132L possibly damaging Het
Parg T A 14: 32,217,662 D548E possibly damaging Het
Pcdhga4 G T 18: 37,687,686 G763W probably benign Het
Pde10a A G 17: 8,949,372 N9S possibly damaging Het
Pi4k2a T C 19: 42,100,641 I147T probably benign Het
Polh T A 17: 46,194,325 T122S probably damaging Het
Ptpn13 T C 5: 103,477,118 V96A possibly damaging Het
Ptpn6 C A 6: 124,728,785 C132F probably damaging Het
Rbm19 T A 5: 120,132,867 V585E probably damaging Het
Rp1l1 C T 14: 64,028,906 P647L probably benign Het
Rrp1b A G 17: 32,047,675 E72G probably damaging Het
Shcbp1 A T 8: 4,748,742 H392Q probably benign Het
Skiv2l C T 17: 34,846,117 R371Q possibly damaging Het
Slc13a5 G A 11: 72,253,391 T287I possibly damaging Het
Slc22a27 T A 19: 7,926,757 E5V probably benign Het
Slc38a2 A G 15: 96,692,584 V293A probably damaging Het
Slco6d1 T A 1: 98,463,836 probably benign Het
Sri G C 5: 8,059,353 D46H probably damaging Het
Tango6 A G 8: 106,689,168 D207G possibly damaging Het
Tigd4 T C 3: 84,594,442 M222T probably benign Het
Tmem229a T C 6: 24,955,173 D194G probably benign Het
Trank1 T C 9: 111,366,685 V1259A possibly damaging Het
Trdv5 T C 14: 54,148,798 D70G probably benign Het
Trim52 T A 14: 106,106,941 M11K probably damaging Het
Wdr62 A G 7: 30,241,347 M882T probably benign Het
Ybx3 A G 6: 131,367,763 probably null Het
Zfand2b A G 1: 75,170,510 probably benign Het
Zfp91 T A 19: 12,770,320 T480S possibly damaging Het
Other mutations in Aggf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Aggf1 APN 13 95362477 missense probably damaging 1.00
IGL01083:Aggf1 APN 13 95356409 missense probably damaging 1.00
IGL01296:Aggf1 APN 13 95353971 missense probably damaging 1.00
IGL01811:Aggf1 APN 13 95351572 missense probably benign 0.04
IGL02089:Aggf1 APN 13 95370929 missense probably benign 0.22
IGL02351:Aggf1 APN 13 95352850 splice site probably benign
IGL02358:Aggf1 APN 13 95352850 splice site probably benign
IGL02534:Aggf1 APN 13 95369522 missense possibly damaging 0.76
PIT4687001:Aggf1 UTSW 13 95364875 missense probably damaging 0.99
R0090:Aggf1 UTSW 13 95364959 missense probably benign 0.01
R0189:Aggf1 UTSW 13 95356480 splice site probably benign
R0332:Aggf1 UTSW 13 95369446 missense probably damaging 1.00
R0334:Aggf1 UTSW 13 95371597 missense probably benign 0.02
R0445:Aggf1 UTSW 13 95354001 missense possibly damaging 0.74
R0523:Aggf1 UTSW 13 95356416 missense probably damaging 0.99
R0575:Aggf1 UTSW 13 95368397 missense probably benign 0.02
R0647:Aggf1 UTSW 13 95371656 splice site probably null
R1401:Aggf1 UTSW 13 95364848 missense probably benign 0.02
R1495:Aggf1 UTSW 13 95356413 nonsense probably null
R1542:Aggf1 UTSW 13 95370942 missense probably benign 0.00
R1688:Aggf1 UTSW 13 95364767 missense probably damaging 1.00
R2225:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R2226:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R4405:Aggf1 UTSW 13 95371594 missense probably benign 0.00
R4764:Aggf1 UTSW 13 95364713 missense probably damaging 0.96
R5819:Aggf1 UTSW 13 95351621 missense possibly damaging 0.76
R5946:Aggf1 UTSW 13 95371576 missense probably damaging 1.00
R6056:Aggf1 UTSW 13 95371615 missense probably benign 0.00
R6823:Aggf1 UTSW 13 95364723 missense probably benign 0.11
R7051:Aggf1 UTSW 13 95351617 missense possibly damaging 0.94
R7638:Aggf1 UTSW 13 95356413 nonsense probably null
R7682:Aggf1 UTSW 13 95368426 missense probably benign 0.41
R7903:Aggf1 UTSW 13 95356458 missense probably damaging 1.00
R7986:Aggf1 UTSW 13 95356458 missense probably damaging 1.00
RF014:Aggf1 UTSW 13 95370768 missense possibly damaging 0.87
X0010:Aggf1 UTSW 13 95364977 missense probably benign
X0064:Aggf1 UTSW 13 95362870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGAGGCAGCTGCAAAC -3'
(R):5'- CAGGCCTCTGTCTTATCTGCAG -3'

Sequencing Primer
(F):5'- CCCAACAGTGCAGTGTTAGG -3'
(R):5'- CTGTCTTATCTGCAGCAAAGAC -3'
Posted On2017-10-20