Incidental Mutation 'R0529:Card10'
ID49073
Institutional Source Beutler Lab
Gene Symbol Card10
Ensembl Gene ENSMUSG00000033170
Gene Namecaspase recruitment domain family, member 10
SynonymsBimp1, CARMA3
MMRRC Submission 038721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0529 (G1)
Quality Score177
Status Validated
Chromosome15
Chromosomal Location78775138-78803042 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 78780475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164826] [ENSMUST00000170584]
Predicted Effect probably null
Transcript: ENSMUST00000164826
SMART Domains Protein: ENSMUSP00000129513
Gene: ENSMUSG00000033170

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
Pfam:CARD 77 163 1.1e-22 PFAM
coiled coil region 188 498 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
low complexity region 607 614 N/A INTRINSIC
low complexity region 692 706 N/A INTRINSIC
PDB:3SHW|A 744 1055 1e-7 PDB
Blast:SH3 747 812 8e-8 BLAST
Blast:GuKc 883 1045 1e-19 BLAST
low complexity region 1057 1068 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170584
SMART Domains Protein: ENSMUSP00000131003
Gene: ENSMUSG00000033170

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:CARD 28 114 5.6e-23 PFAM
coiled coil region 139 449 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
low complexity region 558 565 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
PDB:3SHW|A 695 1006 1e-7 PDB
Blast:SH3 698 763 7e-8 BLAST
Blast:GuKc 834 996 1e-19 BLAST
low complexity region 1008 1019 N/A INTRINSIC
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The caspase recruitment domain (CARD) is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in apoptosis signaling through highly specific protein-protein homophilic interactions. Like several other CARD proteins, CARD10 belongs to the membrane-associated guanylate kinase (MAGUK) family and activates NF-kappa-B (NFKB; see MIM 164011) through BCL10 (MIM 603517) (Wang et al., 2001 [PubMed 11259443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit partial penetrance of anencephaly and subsequent perinatal lethality of anencephalic embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 8,992,396 V126I probably benign Het
Aasdh A C 5: 76,876,267 Y179* probably null Het
Afp A G 5: 90,504,395 Y415C probably damaging Het
Aldh5a1 G T 13: 24,913,873 T393K probably benign Het
Arhgef26 T C 3: 62,339,725 S77P probably benign Het
Axl A G 7: 25,787,287 probably benign Het
Ccdc71l G A 12: 32,379,252 S90N probably damaging Het
Cebpa A T 7: 35,120,199 T261S probably benign Het
Cnmd T C 14: 79,642,041 E219G probably benign Het
Cntln T A 4: 85,067,825 L1010H probably damaging Het
Cul9 A G 17: 46,520,468 probably benign Het
Cyld A G 8: 88,729,759 E479G probably benign Het
Dmp1 A G 5: 104,212,226 E256G probably benign Het
Dnmt1 T C 9: 20,911,550 D1140G probably damaging Het
Drd2 A C 9: 49,407,074 M439L probably benign Het
Drd3 G A 16: 43,822,714 V438M probably damaging Het
Dyrk3 A G 1: 131,130,121 I70T probably benign Het
Fam46c A G 3: 100,472,370 Y357H probably benign Het
Fbxo38 T C 18: 62,505,986 K1082E probably damaging Het
Fbxw10 A C 11: 62,859,845 D428A probably damaging Het
Fmn1 T A 2: 113,707,853 probably benign Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Gda T A 19: 21,425,537 I82F probably damaging Het
Gpatch4 T A 3: 88,051,276 H22Q probably damaging Het
Gpr55 A G 1: 85,941,503 F119L probably benign Het
Gtf2i A T 5: 134,261,869 L425* probably null Het
Knstrn T A 2: 118,830,980 probably benign Het
Lipo2 T A 19: 33,746,935 I144L probably benign Het
Lrp1 T C 10: 127,541,594 probably null Het
Mtmr14 T C 6: 113,266,252 probably benign Het
Nsmce4a A T 7: 130,533,806 S345R probably benign Het
Oacyl T A 18: 65,742,219 V385D probably damaging Het
Olfr421-ps1 G A 1: 174,152,130 A205T probably benign Het
Olfr917 A T 9: 38,665,512 C111S probably benign Het
Phlpp2 T C 8: 109,876,971 S55P probably benign Het
Pkhd1l1 T A 15: 44,526,754 V1422E possibly damaging Het
Plcd3 T G 11: 103,080,187 H181P probably benign Het
Psmc5 G A 11: 106,261,164 probably null Het
Psmd11 T C 11: 80,470,689 probably benign Het
Rab39 T C 9: 53,686,716 Y83C probably damaging Het
Ric8a A G 7: 140,860,893 E93G probably damaging Het
Rtp3 T C 9: 110,987,084 E133G possibly damaging Het
Serpina1e A C 12: 103,949,104 L281R probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tmem63a A T 1: 180,961,094 E332V probably benign Het
Tnk1 T C 11: 69,855,164 T312A probably damaging Het
Traf3ip3 G T 1: 193,194,811 probably benign Het
Trappc11 A G 8: 47,526,979 V174A possibly damaging Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn1r7 T A 6: 57,024,465 Y270F possibly damaging Het
Vmn2r12 A G 5: 109,092,848 V133A probably benign Het
Vmn2r18 T A 5: 151,562,523 E502V probably damaging Het
Wipf3 C A 6: 54,485,363 P186Q probably damaging Het
Yipf5 A T 18: 40,212,162 M55K probably benign Het
Zbtb7a G A 10: 81,143,986 V5M probably damaging Het
Zfy1 G T Y: 726,040 S575Y probably damaging Het
Other mutations in Card10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Card10 APN 15 78778215 missense probably damaging 1.00
IGL02804:Card10 APN 15 78802449 missense probably damaging 1.00
PIT4366001:Card10 UTSW 15 78787431 missense probably benign 0.14
R0571:Card10 UTSW 15 78787401 missense possibly damaging 0.88
R1118:Card10 UTSW 15 78802443 missense possibly damaging 0.90
R1444:Card10 UTSW 15 78787841 splice site probably benign
R1632:Card10 UTSW 15 78791220 nonsense probably null
R1669:Card10 UTSW 15 78793953 missense probably benign 0.20
R1862:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1863:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1997:Card10 UTSW 15 78793975 missense probably damaging 0.99
R2046:Card10 UTSW 15 78787473 missense possibly damaging 0.91
R2084:Card10 UTSW 15 78792971 missense possibly damaging 0.81
R2509:Card10 UTSW 15 78780273 missense probably benign 0.00
R2511:Card10 UTSW 15 78780273 missense probably benign 0.00
R4274:Card10 UTSW 15 78780514 missense probably damaging 1.00
R4887:Card10 UTSW 15 78781524 missense possibly damaging 0.66
R4970:Card10 UTSW 15 78802380 critical splice donor site probably null
R5098:Card10 UTSW 15 78776717 missense probably benign 0.37
R5112:Card10 UTSW 15 78802380 critical splice donor site probably null
R5243:Card10 UTSW 15 78780672 missense possibly damaging 0.70
R5256:Card10 UTSW 15 78778251 missense probably damaging 0.98
R5985:Card10 UTSW 15 78791211 missense probably benign 0.01
R6089:Card10 UTSW 15 78802414 missense probably benign 0.02
R6357:Card10 UTSW 15 78799379 missense probably damaging 1.00
R6545:Card10 UTSW 15 78776810 missense probably damaging 1.00
R6865:Card10 UTSW 15 78802622 missense possibly damaging 0.70
R6907:Card10 UTSW 15 78787471 missense possibly damaging 0.82
R6920:Card10 UTSW 15 78802409 nonsense probably null
R7913:Card10 UTSW 15 78781103 missense possibly damaging 0.63
R8258:Card10 UTSW 15 78776684 missense probably damaging 1.00
R8259:Card10 UTSW 15 78776684 missense probably damaging 1.00
Z1177:Card10 UTSW 15 78795328 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCAGGGATGACCGAATACTCAGCC -3'
(R):5'- GAGCCCTTCTACATTCGAGCCAAC -3'

Sequencing Primer
(F):5'- CTGGAGATCAAGTATTTTTCCTGGAC -3'
(R):5'- ACATTCGAGCCAACTTCTCC -3'
Posted On2013-06-12