Mutagenetix > Incidental Mutations

Incidental Mutation 'R0529:Card10'

49073

Institutional Source

Beutler Lab

Gene Symbol

Card10

Ensembl Gene

ENSMUSG00000033170

Gene Name

caspase recruitment domain family, member 10

Synonyms

Bimp1, CARMA3

MMRRC Submission

038721-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R0529 (G1)

Quality Score

177

Status

Validated

Chromosome

Chromosomal Location

78775138-78803042 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 78780475 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164826] [ENSMUST00000170584]

Predicted Effect

probably null
Transcript: ENSMUST00000164826

SMART Domains

Protein: ENSMUSP00000129513
Gene: ENSMUSG00000033170

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	54	75	N/A	INTRINSIC
Pfam:CARD	77	163	1.1e-22	PFAM
coiled coil region	188	498	N/A	INTRINSIC
low complexity region	508	523	N/A	INTRINSIC
low complexity region	607	614	N/A	INTRINSIC
low complexity region	692	706	N/A	INTRINSIC
PDB:3SHW\|A	744	1055	1e-7	PDB
Blast:SH3	747	812	8e-8	BLAST
Blast:GuKc	883	1045	1e-19	BLAST
low complexity region	1057	1068	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000170584

SMART Domains

Protein: ENSMUSP00000131003
Gene: ENSMUSG00000033170

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
Pfam:CARD	28	114	5.6e-23	PFAM
coiled coil region	139	449	N/A	INTRINSIC
low complexity region	459	474	N/A	INTRINSIC
low complexity region	558	565	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
PDB:3SHW\|A	695	1006	1e-7	PDB
Blast:SH3	698	763	7e-8	BLAST
Blast:GuKc	834	996	1e-19	BLAST
low complexity region	1008	1019	N/A	INTRINSIC

Meta Mutation Damage Score

0.9490

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.3%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The caspase recruitment domain (CARD) is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in apoptosis signaling through highly specific protein-protein homophilic interactions. Like several other CARD proteins, CARD10 belongs to the membrane-associated guanylate kinase (MAGUK) family and activates NF-kappa-B (NFKB; see MIM 164011) through BCL10 (MIM 603517) (Wang et al., 2001 [PubMed 11259443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit partial penetrance of anencephaly and subsequent perinatal lethality of anencephalic embryos. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	A	17: 8,992,396	V126I	probably benign	Het
Aasdh	A	C	5: 76,876,267	Y179*	probably null	Het
Afp	A	G	5: 90,504,395	Y415C	probably damaging	Het
Aldh5a1	G	T	13: 24,913,873	T393K	probably benign	Het
Arhgef26	T	C	3: 62,339,725	S77P	probably benign	Het
Axl	A	G	7: 25,787,287		probably benign	Het
Ccdc71l	G	A	12: 32,379,252	S90N	probably damaging	Het
Cebpa	A	T	7: 35,120,199	T261S	probably benign	Het
Cnmd	T	C	14: 79,642,041	E219G	probably benign	Het
Cntln	T	A	4: 85,067,825	L1010H	probably damaging	Het
Cul9	A	G	17: 46,520,468		probably benign	Het
Cyld	A	G	8: 88,729,759	E479G	probably benign	Het
Dmp1	A	G	5: 104,212,226	E256G	probably benign	Het
Dnmt1	T	C	9: 20,911,550	D1140G	probably damaging	Het
Drd2	A	C	9: 49,407,074	M439L	probably benign	Het
Drd3	G	A	16: 43,822,714	V438M	probably damaging	Het
Dyrk3	A	G	1: 131,130,121	I70T	probably benign	Het
Fam46c	A	G	3: 100,472,370	Y357H	probably benign	Het
Fbxo38	T	C	18: 62,505,986	K1082E	probably damaging	Het
Fbxw10	A	C	11: 62,859,845	D428A	probably damaging	Het
Fmn1	T	A	2: 113,707,853		probably benign	Het
Fmnl2	A	T	2: 53,042,365	I119F	probably damaging	Het
Frmd4a	A	G	2: 4,606,023	T995A	probably damaging	Het
Gda	T	A	19: 21,425,537	I82F	probably damaging	Het
Gpatch4	T	A	3: 88,051,276	H22Q	probably damaging	Het
Gpr55	A	G	1: 85,941,503	F119L	probably benign	Het
Gtf2i	A	T	5: 134,261,869	L425*	probably null	Het
Knstrn	T	A	2: 118,830,980		probably benign	Het
Lipo2	T	A	19: 33,746,935	I144L	probably benign	Het
Lrp1	T	C	10: 127,541,594		probably null	Het
Mtmr14	T	C	6: 113,266,252		probably benign	Het
Nsmce4a	A	T	7: 130,533,806	S345R	probably benign	Het
Oacyl	T	A	18: 65,742,219	V385D	probably damaging	Het
Olfr421-ps1	G	A	1: 174,152,130	A205T	probably benign	Het
Olfr917	A	T	9: 38,665,512	C111S	probably benign	Het
Phlpp2	T	C	8: 109,876,971	S55P	probably benign	Het
Pkhd1l1	T	A	15: 44,526,754	V1422E	possibly damaging	Het
Plcd3	T	G	11: 103,080,187	H181P	probably benign	Het
Psmc5	G	A	11: 106,261,164		probably null	Het
Psmd11	T	C	11: 80,470,689		probably benign	Het
Rab39	T	C	9: 53,686,716	Y83C	probably damaging	Het
Ric8a	A	G	7: 140,860,893	E93G	probably damaging	Het
Rtp3	T	C	9: 110,987,084	E133G	possibly damaging	Het
Serpina1e	A	C	12: 103,949,104	L281R	probably damaging	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Tmem63a	A	T	1: 180,961,094	E332V	probably benign	Het
Tnk1	T	C	11: 69,855,164	T312A	probably damaging	Het
Traf3ip3	G	T	1: 193,194,811		probably benign	Het
Trappc11	A	G	8: 47,526,979	V174A	possibly damaging	Het
Vmn1r174	G	A	7: 23,754,197	R96H	probably benign	Het
Vmn1r7	T	A	6: 57,024,465	Y270F	possibly damaging	Het
Vmn2r12	A	G	5: 109,092,848	V133A	probably benign	Het
Vmn2r18	T	A	5: 151,562,523	E502V	probably damaging	Het
Wipf3	C	A	6: 54,485,363	P186Q	probably damaging	Het
Yipf5	A	T	18: 40,212,162	M55K	probably benign	Het
Zbtb7a	G	A	10: 81,143,986	V5M	probably damaging	Het
Zfy1	G	T	Y: 726,040	S575Y	probably damaging	Het

Other mutations in Card10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02061:Card10	APN	15	78778215	missense	probably damaging	1.00
IGL02804:Card10	APN	15	78802449	missense	probably damaging	1.00
PIT4366001:Card10	UTSW	15	78787431	missense	probably benign	0.14
R0571:Card10	UTSW	15	78787401	missense	possibly damaging	0.88
R1118:Card10	UTSW	15	78802443	missense	possibly damaging	0.90
R1444:Card10	UTSW	15	78787841	splice site	probably benign
R1632:Card10	UTSW	15	78791220	nonsense	probably null
R1669:Card10	UTSW	15	78793953	missense	probably benign	0.20
R1862:Card10	UTSW	15	78780514	missense	probably damaging	1.00
R1863:Card10	UTSW	15	78780514	missense	probably damaging	1.00
R1997:Card10	UTSW	15	78793975	missense	probably damaging	0.99
R2046:Card10	UTSW	15	78787473	missense	possibly damaging	0.91
R2084:Card10	UTSW	15	78792971	missense	possibly damaging	0.81
R2509:Card10	UTSW	15	78780273	missense	probably benign	0.00
R2511:Card10	UTSW	15	78780273	missense	probably benign	0.00
R4274:Card10	UTSW	15	78780514	missense	probably damaging	1.00
R4887:Card10	UTSW	15	78781524	missense	possibly damaging	0.66
R4970:Card10	UTSW	15	78802380	critical splice donor site	probably null
R5098:Card10	UTSW	15	78776717	missense	probably benign	0.37
R5112:Card10	UTSW	15	78802380	critical splice donor site	probably null
R5243:Card10	UTSW	15	78780672	missense	possibly damaging	0.70
R5256:Card10	UTSW	15	78778251	missense	probably damaging	0.98
R5985:Card10	UTSW	15	78791211	missense	probably benign	0.01
R6089:Card10	UTSW	15	78802414	missense	probably benign	0.02
R6357:Card10	UTSW	15	78799379	missense	probably damaging	1.00
R6545:Card10	UTSW	15	78776810	missense	probably damaging	1.00
R6865:Card10	UTSW	15	78802622	missense	possibly damaging	0.70
R6907:Card10	UTSW	15	78787471	missense	possibly damaging	0.82
R6920:Card10	UTSW	15	78802409	nonsense	probably null
R7913:Card10	UTSW	15	78781103	missense	possibly damaging	0.63
R8258:Card10	UTSW	15	78776684	missense	probably damaging	1.00
R8259:Card10	UTSW	15	78776684	missense	probably damaging	1.00
Z1177:Card10	UTSW	15	78795328	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCAGGGATGACCGAATACTCAGCC -3'
(R):5'- GAGCCCTTCTACATTCGAGCCAAC -3'

Sequencing Primer
(F):5'- CTGGAGATCAAGTATTTTTCCTGGAC -3'
(R):5'- ACATTCGAGCCAACTTCTCC -3'

Posted On

2013-06-12