Incidental Mutation 'R5801:Stk10'
ID490738
Institutional Source Beutler Lab
Gene Symbol Stk10
Ensembl Gene ENSMUSG00000020272
Gene Nameserine/threonine kinase 10
SynonymsGek1, Lok
MMRRC Submission 043390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5801 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location32533305-32624587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32596748 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 335 (P335L)
Ref Sequence ENSEMBL: ENSMUSP00000099885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102821]
Predicted Effect probably benign
Transcript: ENSMUST00000102821
AA Change: P335L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099885
Gene: ENSMUSG00000020272
AA Change: P335L

DomainStartEndE-ValueType
S_TKc 36 294 8.66e-92 SMART
low complexity region 316 334 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
Pfam:PKK 586 724 1.9e-41 PFAM
Pfam:PKK 754 894 2.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143397
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. Mice deficient for this gene product are viable, but exhibit altered integrin-mediated lymphocyte adhesion characteristics. The orthologous gene product in humans can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in enhanced cell adhesion in mitogen-stimulated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 C T 3: 89,342,361 V667I probably damaging Het
Adamts14 T C 10: 61,202,996 S912G probably damaging Het
Adamts20 C A 15: 94,347,670 E584* probably null Het
Ago3 A T 4: 126,371,768 N284K possibly damaging Het
Alx3 T A 3: 107,604,941 Y298* probably null Het
Arhgap32 A G 9: 32,255,788 I574V probably benign Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Caskin2 T C 11: 115,803,473 D400G probably damaging Het
Cdc73 T A 1: 143,608,543 H525L probably benign Het
Cep135 A G 5: 76,630,676 E674G probably damaging Het
Cic G A 7: 25,271,438 R198Q possibly damaging Het
Col5a2 T C 1: 45,389,481 probably null Het
Col6a5 A G 9: 105,948,367 V9A unknown Het
Cpsf7 A T 19: 10,539,632 D366V probably benign Het
Cuedc2 T C 19: 46,331,357 E173G probably damaging Het
D5Ertd579e T C 5: 36,604,569 E1318G probably damaging Het
Ddx55 T C 5: 124,566,497 probably null Het
Dennd1b T A 1: 139,039,989 probably null Het
Dpy19l3 T C 7: 35,725,298 T111A probably benign Het
Edn1 C A 13: 42,306,806 A179E probably benign Het
Eif2b1 T C 5: 124,574,712 probably null Het
Epha5 A G 5: 84,331,226 probably null Het
Erc1 T A 6: 119,773,822 N466I probably damaging Het
Ermp1 A G 19: 29,612,828 F825L probably damaging Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fbxo41 G T 6: 85,484,533 F64L probably damaging Het
Gabrb2 T C 11: 42,421,389 S14P probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm6505 A T 3: 28,764,967 noncoding transcript Het
Ighv1-18 T A 12: 114,682,708 D91V probably damaging Het
Imp3 A G 9: 56,937,802 D99G probably benign Het
Iqub T C 6: 24,449,769 K699R probably benign Het
Itpk1 A G 12: 102,573,945 V293A probably damaging Het
Lrrc49 A T 9: 60,602,633 F157L probably damaging Het
Mapk1ip1 T A 7: 138,836,510 T64S possibly damaging Het
Mrpl9 T C 3: 94,447,796 L225P possibly damaging Het
Ms4a14 A G 19: 11,301,786 L1136S possibly damaging Het
Ms4a14 A T 19: 11,301,882 I1104K possibly damaging Het
Nkain2 T C 10: 32,402,268 T54A probably damaging Het
Ociad2 A G 5: 73,326,299 F60S probably damaging Het
Olfr397 T C 11: 73,964,946 F113L probably benign Het
Polk T A 13: 96,483,586 H723L probably damaging Het
Prickle4 C A 17: 47,688,773 R285L possibly damaging Het
Psmd2 A G 16: 20,654,922 N121S probably damaging Het
Rab11fip5 T A 6: 85,337,600 S1212C probably damaging Het
Rasgef1c T G 11: 49,970,056 M266R probably damaging Het
Rpusd4 A G 9: 35,270,073 E155G possibly damaging Het
Rrbp1 A G 2: 143,989,783 S155P probably damaging Het
Safb2 T C 17: 56,563,103 Y991C possibly damaging Het
Shank1 G A 7: 44,356,816 E1986K possibly damaging Het
Slc22a14 A G 9: 119,172,083 F482L probably benign Het
Slc35e3 T A 10: 117,745,862 M109L probably benign Het
Slco4c1 T C 1: 96,872,084 N9S probably damaging Het
Slco6b1 C T 1: 96,947,631 noncoding transcript Het
Sptan1 A G 2: 30,030,601 probably null Het
Sptlc2 T C 12: 87,341,771 probably null Het
Strip1 A C 3: 107,621,441 L391R possibly damaging Het
Tacr1 T A 6: 82,557,153 S387T probably benign Het
Thbs2 A T 17: 14,687,863 F213I probably damaging Het
Thbs3 A T 3: 89,224,397 Y692F probably benign Het
Tktl2 C A 8: 66,513,647 A619E probably benign Het
Tmc3 A T 7: 83,622,478 E946V possibly damaging Het
Tmem132d A G 5: 127,784,900 V719A possibly damaging Het
Trpa1 T C 1: 14,898,078 H488R probably damaging Het
Tsfm TCACTCC TCACTCCACTCC 10: 127,022,837 probably null Het
Wdr35 A G 12: 9,006,723 T503A possibly damaging Het
Zfp109 T C 7: 24,228,701 K436E probably damaging Het
Zfp423 A G 8: 87,859,362 Y78H probably damaging Het
Zfp970 A G 2: 177,473,358 K26E probably damaging Het
Other mutations in Stk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Stk10 APN 11 32577740 missense probably benign 0.33
IGL01285:Stk10 APN 11 32610653 missense possibly damaging 0.91
IGL01983:Stk10 APN 11 32589460 missense probably benign 0.05
IGL03177:Stk10 APN 11 32614592 missense probably damaging 1.00
IGL03183:Stk10 APN 11 32604143 missense possibly damaging 0.50
coquet UTSW 11 32577764 missense
legacy UTSW 11 32604166 nonsense probably null
mignon UTSW 11 32587363 missense probably damaging 1.00
FR4976:Stk10 UTSW 11 32614520 critical splice acceptor site probably benign
R0003:Stk10 UTSW 11 32589460 missense probably benign 0.05
R0008:Stk10 UTSW 11 32587305 splice site probably benign
R0056:Stk10 UTSW 11 32617851 missense possibly damaging 0.95
R0076:Stk10 UTSW 11 32603722 missense probably benign
R0227:Stk10 UTSW 11 32617859 missense probably damaging 1.00
R0440:Stk10 UTSW 11 32604190 missense probably damaging 1.00
R0454:Stk10 UTSW 11 32596724 missense probably damaging 0.99
R0481:Stk10 UTSW 11 32614708 missense probably damaging 1.00
R0504:Stk10 UTSW 11 32617882 missense probably benign 0.04
R0790:Stk10 UTSW 11 32598653 missense probably benign 0.00
R1439:Stk10 UTSW 11 32617919 missense probably damaging 0.98
R1539:Stk10 UTSW 11 32533440 missense possibly damaging 0.85
R1770:Stk10 UTSW 11 32622464 missense possibly damaging 0.94
R4304:Stk10 UTSW 11 32610634 missense probably damaging 0.97
R4430:Stk10 UTSW 11 32533552 missense possibly damaging 0.81
R4702:Stk10 UTSW 11 32555172 missense probably benign 0.28
R4797:Stk10 UTSW 11 32598471 missense probably benign 0.01
R5447:Stk10 UTSW 11 32604166 nonsense probably null
R5802:Stk10 UTSW 11 32596748 missense probably benign 0.01
R6129:Stk10 UTSW 11 32615871 missense probably damaging 1.00
R6154:Stk10 UTSW 11 32603654 splice site probably null
R6175:Stk10 UTSW 11 32603761 missense possibly damaging 0.46
R6185:Stk10 UTSW 11 32577749 missense probably benign 0.13
R6520:Stk10 UTSW 11 32588839 missense probably damaging 1.00
R6824:Stk10 UTSW 11 32587363 missense probably damaging 1.00
R7259:Stk10 UTSW 11 32598497 missense probably benign 0.00
R7649:Stk10 UTSW 11 32577764 missense
X0027:Stk10 UTSW 11 32587361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGAGTTGTTCCTCGTTG -3'
(R):5'- GCTCCAGAACTTAGACCTGG -3'

Sequencing Primer
(F):5'- TCGTTGCTTCAGGACCAAG -3'
(R):5'- AACTTAGACCTGGCCAGTTG -3'
Posted On2017-10-24