Incidental Mutation 'R0530:Abcg3'
ID 49094
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission 038722-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0530 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105083920 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 617 (W617R)
Ref Sequence ENSEMBL: ENSMUSP00000031239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably damaging
Transcript: ENSMUST00000031239
AA Change: W617R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: W617R

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178720
Meta Mutation Damage Score 0.8733 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l A T 8: 44,079,568 (GRCm39) C219S probably benign Het
Cep83 A T 10: 94,555,450 (GRCm39) probably benign Het
Ces1e G A 8: 93,946,149 (GRCm39) probably benign Het
Ckap2 A G 8: 22,665,988 (GRCm39) probably benign Het
Clip1 C A 5: 123,778,594 (GRCm39) R443L probably damaging Het
Clmp A G 9: 40,672,302 (GRCm39) D44G probably benign Het
Cntnap2 G A 6: 46,506,839 (GRCm39) Q304* probably null Het
Cst7 A T 2: 150,412,435 (GRCm39) probably benign Het
Dclk3 A T 9: 111,311,789 (GRCm39) Y677F probably damaging Het
Dlat G T 9: 50,548,869 (GRCm39) N562K probably damaging Het
Elmod1 A T 9: 53,833,260 (GRCm39) Y182N probably damaging Het
Fzd10 T C 5: 128,679,077 (GRCm39) F266L probably damaging Het
Gm8258 A G 5: 104,923,952 (GRCm39) noncoding transcript Het
Gm9742 T A 13: 8,080,041 (GRCm39) noncoding transcript Het
Hdlbp T C 1: 93,358,039 (GRCm39) probably benign Het
Itga8 A G 2: 12,196,627 (GRCm39) S597P probably damaging Het
Kndc1 A T 7: 139,481,153 (GRCm39) I80F probably damaging Het
Ktn1 A G 14: 47,970,700 (GRCm39) N1192S probably benign Het
Ldha G A 7: 46,503,417 (GRCm39) V270M probably damaging Het
Lyst T C 13: 13,931,891 (GRCm39) probably benign Het
Map3k9 A T 12: 81,769,256 (GRCm39) F954I probably benign Het
Mroh2b A G 15: 4,963,877 (GRCm39) N823S probably damaging Het
Mycbp2 A T 14: 103,419,895 (GRCm39) N2480K probably damaging Het
Nat1 A G 8: 67,943,977 (GRCm39) K121E probably benign Het
Neurl1b T A 17: 26,660,519 (GRCm39) probably null Het
Nnt C A 13: 119,531,257 (GRCm39) L163F probably damaging Het
Or10v5 A G 19: 11,805,556 (GRCm39) V278A probably benign Het
Otog A G 7: 45,947,668 (GRCm39) T2274A probably damaging Het
Pde4b G A 4: 102,459,848 (GRCm39) R561Q probably damaging Het
Pitpnm2 A G 5: 124,269,264 (GRCm39) F453L probably damaging Het
Pms1 T C 1: 53,235,972 (GRCm39) probably null Het
Pot1a A G 6: 25,771,540 (GRCm39) V227A possibly damaging Het
Prdx6b A G 2: 80,123,659 (GRCm39) N156S probably damaging Het
Ptpn9 A G 9: 56,968,417 (GRCm39) S586G probably benign Het
Serpina6 A T 12: 103,618,053 (GRCm39) N253K probably damaging Het
Slc12a2 T A 18: 58,052,608 (GRCm39) V809D possibly damaging Het
Slc2a8 C T 2: 32,863,696 (GRCm39) A449T probably benign Het
Slc6a6 A G 6: 91,701,939 (GRCm39) I116V probably null Het
Synj2 T A 17: 6,058,380 (GRCm39) S58R possibly damaging Het
Tafa3 T C 3: 104,679,487 (GRCm39) probably benign Het
Tktl2 T C 8: 66,965,831 (GRCm39) V463A probably damaging Het
Uchl5 T C 1: 143,670,082 (GRCm39) V105A possibly damaging Het
Usp9y T C Y: 1,333,600 (GRCm39) probably benign Het
Vmn1r200 T C 13: 22,579,667 (GRCm39) S148P probably damaging Het
Vmn2r50 A T 7: 9,781,644 (GRCm39) M367K possibly damaging Het
Vps13a T C 19: 16,632,570 (GRCm39) probably benign Het
Wdr26 A T 1: 181,013,635 (GRCm39) probably null Het
Wdr87-ps A G 7: 29,229,545 (GRCm39) noncoding transcript Het
Ythdc2 T A 18: 44,983,465 (GRCm39) M544K probably damaging Het
Zpld2 A G 4: 133,930,221 (GRCm39) I28T probably benign Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCTCTCCAGTAGCCAATAGC -3'
(R):5'- ACAATGGTGACTGCCTCACATAGATTC -3'

Sequencing Primer
(F):5'- catttccattccttcttttcatcatc -3'
(R):5'- GACTGCCTCACATAGATTCAGATG -3'
Posted On 2013-06-12