Incidental Mutation 'R0530:Fzd10'
ID 49097
Institutional Source Beutler Lab
Gene Symbol Fzd10
Ensembl Gene ENSMUSG00000081683
Gene Name frizzled class receptor 10
Synonyms Fz-10
MMRRC Submission 038722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0530 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 128600844-128604093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128602013 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 266 (F266L)
Ref Sequence ENSEMBL: ENSMUSP00000114114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117102]
AlphaFold Q8BKG4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091324
Predicted Effect probably damaging
Transcript: ENSMUST00000117102
AA Change: F266L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: F266L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FRI 34 153 7.83e-68 SMART
Frizzled 218 542 2.62e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199981
Meta Mutation Damage Score 0.5029 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,530,120 noncoding transcript Het
Abcg3 A G 5: 104,936,054 W617R probably damaging Het
Cep83 A T 10: 94,719,588 probably benign Het
Ces1e G A 8: 93,219,521 probably benign Het
Ckap2 A G 8: 22,175,972 probably benign Het
Clip1 C A 5: 123,640,531 R443L probably damaging Het
Clmp A G 9: 40,761,006 D44G probably benign Het
Cntnap2 G A 6: 46,529,905 Q304* probably null Het
Cst7 A T 2: 150,570,515 probably benign Het
Dclk3 A T 9: 111,482,721 Y677F probably damaging Het
Dlat G T 9: 50,637,569 N562K probably damaging Het
Elmod1 A T 9: 53,925,976 Y182N probably damaging Het
Fam19a3 T C 3: 104,772,171 probably benign Het
Gm5346 A T 8: 43,626,531 C219S probably benign Het
Gm7534 A G 4: 134,202,910 I28T probably benign Het
Gm8258 A G 5: 104,776,086 noncoding transcript Het
Gm9742 T A 13: 8,030,005 noncoding transcript Het
Hdlbp T C 1: 93,430,317 probably benign Het
Itga8 A G 2: 12,191,816 S597P probably damaging Het
Kndc1 A T 7: 139,901,237 I80F probably damaging Het
Ktn1 A G 14: 47,733,243 N1192S probably benign Het
Ldha G A 7: 46,853,993 V270M probably damaging Het
Lyst T C 13: 13,757,306 probably benign Het
Map3k9 A T 12: 81,722,482 F954I probably benign Het
Mroh2b A G 15: 4,934,395 N823S probably damaging Het
Mycbp2 A T 14: 103,182,459 N2480K probably damaging Het
Nat1 A G 8: 67,491,325 K121E probably benign Het
Neurl1b T A 17: 26,441,545 probably null Het
Nnt C A 13: 119,394,721 L163F probably damaging Het
Olfr1417 A G 19: 11,828,192 V278A probably benign Het
Otog A G 7: 46,298,244 T2274A probably damaging Het
Pde4b G A 4: 102,602,651 R561Q probably damaging Het
Pitpnm2 A G 5: 124,131,201 F453L probably damaging Het
Pms1 T C 1: 53,196,813 probably null Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Prdx6b A G 2: 80,293,315 N156S probably damaging Het
Ptpn9 A G 9: 57,061,133 S586G probably benign Het
Serpina6 A T 12: 103,651,794 N253K probably damaging Het
Slc12a2 T A 18: 57,919,536 V809D possibly damaging Het
Slc2a8 C T 2: 32,973,684 A449T probably benign Het
Slc6a6 A G 6: 91,724,958 I116V probably null Het
Synj2 T A 17: 6,008,105 S58R possibly damaging Het
Tktl2 T C 8: 66,513,179 V463A probably damaging Het
Uchl5 T C 1: 143,794,344 V105A possibly damaging Het
Usp9y T C Y: 1,333,600 probably benign Het
Vmn1r200 T C 13: 22,395,497 S148P probably damaging Het
Vmn2r50 A T 7: 10,047,717 M367K possibly damaging Het
Vps13a T C 19: 16,655,206 probably benign Het
Wdr26 A T 1: 181,186,070 probably null Het
Ythdc2 T A 18: 44,850,398 M544K probably damaging Het
Other mutations in Fzd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Fzd10 APN 5 128601528 missense probably damaging 1.00
IGL02354:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL02361:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL03088:Fzd10 APN 5 128602605 missense possibly damaging 0.81
R0645:Fzd10 UTSW 5 128602598 missense possibly damaging 0.94
R1515:Fzd10 UTSW 5 128602559 missense probably damaging 1.00
R3930:Fzd10 UTSW 5 128602412 missense probably damaging 1.00
R4467:Fzd10 UTSW 5 128601276 missense probably benign 0.01
R4976:Fzd10 UTSW 5 128602114 nonsense probably null
R5156:Fzd10 UTSW 5 128601302 missense possibly damaging 0.68
R5202:Fzd10 UTSW 5 128602116 missense possibly damaging 0.78
R5874:Fzd10 UTSW 5 128601300 missense probably benign 0.41
R6238:Fzd10 UTSW 5 128602931 missense probably damaging 0.99
R6921:Fzd10 UTSW 5 128601582 missense probably damaging 0.99
R7684:Fzd10 UTSW 5 128601416 missense possibly damaging 0.73
R8093:Fzd10 UTSW 5 128602239 missense probably benign 0.14
R9011:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9013:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9014:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9332:Fzd10 UTSW 5 128601252 missense possibly damaging 0.92
Z1088:Fzd10 UTSW 5 128601246 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGACAACCCAGGCAAGTTCC -3'
(R):5'- AGCATTGACATCCATGCTGCCC -3'

Sequencing Primer
(F):5'- CATGTGGAGAAGAGCGAATCTTG -3'
(R):5'- ATAGTCTTCACAGCCGGGATG -3'
Posted On 2013-06-12