Incidental Mutation 'R0530:Ckap2'
ID49105
Institutional Source Beutler Lab
Gene Symbol Ckap2
Ensembl Gene ENSMUSG00000037725
Gene Namecytoskeleton associated protein 2
SynonymsLB1
MMRRC Submission 038722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R0530 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22168160-22185819 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 22175972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046916]
Predicted Effect probably benign
Transcript: ENSMUST00000046916
SMART Domains Protein: ENSMUSP00000039518
Gene: ENSMUSG00000037725

DomainStartEndE-ValueType
low complexity region 221 234 N/A INTRINSIC
Pfam:CKAP2_C 315 651 3.9e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211045
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that stabalizes microtubules and plays a role in the regulation of cell division. The encoded protein is itself regulated through phosphorylation at multiple serine and threonine residues. There is a pseudogene of this gene on chromosome 14. Alternative splicing results in multiple transcript variations. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,530,120 noncoding transcript Het
Abcg3 A G 5: 104,936,054 W617R probably damaging Het
Cep83 A T 10: 94,719,588 probably benign Het
Ces1e G A 8: 93,219,521 probably benign Het
Clip1 C A 5: 123,640,531 R443L probably damaging Het
Clmp A G 9: 40,761,006 D44G probably benign Het
Cntnap2 G A 6: 46,529,905 Q304* probably null Het
Cst7 A T 2: 150,570,515 probably benign Het
Dclk3 A T 9: 111,482,721 Y677F probably damaging Het
Dlat G T 9: 50,637,569 N562K probably damaging Het
Elmod1 A T 9: 53,925,976 Y182N probably damaging Het
Fam19a3 T C 3: 104,772,171 probably benign Het
Fzd10 T C 5: 128,602,013 F266L probably damaging Het
Gm5346 A T 8: 43,626,531 C219S probably benign Het
Gm7534 A G 4: 134,202,910 I28T probably benign Het
Gm8258 A G 5: 104,776,086 noncoding transcript Het
Gm9742 T A 13: 8,030,005 noncoding transcript Het
Hdlbp T C 1: 93,430,317 probably benign Het
Itga8 A G 2: 12,191,816 S597P probably damaging Het
Kndc1 A T 7: 139,901,237 I80F probably damaging Het
Ktn1 A G 14: 47,733,243 N1192S probably benign Het
Ldha G A 7: 46,853,993 V270M probably damaging Het
Lyst T C 13: 13,757,306 probably benign Het
Map3k9 A T 12: 81,722,482 F954I probably benign Het
Mroh2b A G 15: 4,934,395 N823S probably damaging Het
Mycbp2 A T 14: 103,182,459 N2480K probably damaging Het
Nat1 A G 8: 67,491,325 K121E probably benign Het
Neurl1b T A 17: 26,441,545 probably null Het
Nnt C A 13: 119,394,721 L163F probably damaging Het
Olfr1417 A G 19: 11,828,192 V278A probably benign Het
Otog A G 7: 46,298,244 T2274A probably damaging Het
Pde4b G A 4: 102,602,651 R561Q probably damaging Het
Pitpnm2 A G 5: 124,131,201 F453L probably damaging Het
Pms1 T C 1: 53,196,813 probably null Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Prdx6b A G 2: 80,293,315 N156S probably damaging Het
Ptpn9 A G 9: 57,061,133 S586G probably benign Het
Serpina6 A T 12: 103,651,794 N253K probably damaging Het
Slc12a2 T A 18: 57,919,536 V809D possibly damaging Het
Slc2a8 C T 2: 32,973,684 A449T probably benign Het
Slc6a6 A G 6: 91,724,958 I116V probably null Het
Synj2 T A 17: 6,008,105 S58R possibly damaging Het
Tktl2 T C 8: 66,513,179 V463A probably damaging Het
Uchl5 T C 1: 143,794,344 V105A possibly damaging Het
Usp9y T C Y: 1,333,600 probably benign Het
Vmn1r200 T C 13: 22,395,497 S148P probably damaging Het
Vmn2r50 A T 7: 10,047,717 M367K possibly damaging Het
Vps13a T C 19: 16,655,206 probably benign Het
Wdr26 A T 1: 181,186,070 probably null Het
Ythdc2 T A 18: 44,850,398 M544K probably damaging Het
Other mutations in Ckap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Ckap2 APN 8 22169758 missense probably damaging 1.00
IGL01519:Ckap2 APN 8 22168898 missense probably benign 0.00
R1638:Ckap2 UTSW 8 22175796 missense possibly damaging 0.84
R1965:Ckap2 UTSW 8 22175787 missense possibly damaging 0.95
R2047:Ckap2 UTSW 8 22168747 missense probably benign 0.03
R3023:Ckap2 UTSW 8 22175861 missense possibly damaging 0.95
R3843:Ckap2 UTSW 8 22175758 missense probably damaging 0.98
R4587:Ckap2 UTSW 8 22176976 missense probably benign
R4754:Ckap2 UTSW 8 22168895 missense possibly damaging 0.93
R4847:Ckap2 UTSW 8 22175068 missense probably damaging 0.98
R5354:Ckap2 UTSW 8 22177565 missense probably damaging 0.96
R5423:Ckap2 UTSW 8 22177196 missense probably benign 0.33
R5717:Ckap2 UTSW 8 22175047 missense probably damaging 0.98
R6518:Ckap2 UTSW 8 22173303 missense probably benign 0.41
R7088:Ckap2 UTSW 8 22169866 missense possibly damaging 0.59
R7466:Ckap2 UTSW 8 22177386 missense probably benign 0.02
R7943:Ckap2 UTSW 8 22175074 missense probably damaging 0.97
X0058:Ckap2 UTSW 8 22176798 missense probably benign
Z1176:Ckap2 UTSW 8 22169794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCACACATACACATCTCAGC -3'
(R):5'- TGTTCCAGCAGTTTAGAACGATGGATAG -3'

Sequencing Primer
(F):5'- cataaatacagacaaaacagccatac -3'
(R):5'- cccacggaggccagaag -3'
Posted On2013-06-12