Incidental Mutation 'R0530:Clmp'
ID49110
Institutional Source Beutler Lab
Gene Symbol Clmp
Ensembl Gene ENSMUSG00000032024
Gene NameCXADR-like membrane protein
Synonyms
MMRRC Submission 038722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0530 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40685962-40785319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40761006 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 44 (D44G)
Ref Sequence ENSEMBL: ENSMUSP00000034522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034522]
Predicted Effect probably benign
Transcript: ENSMUST00000034522
AA Change: D44G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034522
Gene: ENSMUSG00000032024
AA Change: D44G

DomainStartEndE-ValueType
IG 19 128 3.46e-7 SMART
IGc2 143 214 1.29e-6 SMART
transmembrane domain 233 255 N/A INTRINSIC
low complexity region 287 313 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216792
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. Expression of this gene in white adipose tissue is implicated in adipocyte maturation and development of obesity. This gene is also essential for normal intestinal development and mutations in the gene are associated with congenital short bowel syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit reduced viability, bilateral hydronephrosis, increased mean systolic blood pressure, and exhibit several blood chemistry and neurological anomalies. Null mice are samller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,530,120 noncoding transcript Het
Abcg3 A G 5: 104,936,054 W617R probably damaging Het
Cep83 A T 10: 94,719,588 probably benign Het
Ces1e G A 8: 93,219,521 probably benign Het
Ckap2 A G 8: 22,175,972 probably benign Het
Clip1 C A 5: 123,640,531 R443L probably damaging Het
Cntnap2 G A 6: 46,529,905 Q304* probably null Het
Cst7 A T 2: 150,570,515 probably benign Het
Dclk3 A T 9: 111,482,721 Y677F probably damaging Het
Dlat G T 9: 50,637,569 N562K probably damaging Het
Elmod1 A T 9: 53,925,976 Y182N probably damaging Het
Fam19a3 T C 3: 104,772,171 probably benign Het
Fzd10 T C 5: 128,602,013 F266L probably damaging Het
Gm5346 A T 8: 43,626,531 C219S probably benign Het
Gm7534 A G 4: 134,202,910 I28T probably benign Het
Gm8258 A G 5: 104,776,086 noncoding transcript Het
Gm9742 T A 13: 8,030,005 noncoding transcript Het
Hdlbp T C 1: 93,430,317 probably benign Het
Itga8 A G 2: 12,191,816 S597P probably damaging Het
Kndc1 A T 7: 139,901,237 I80F probably damaging Het
Ktn1 A G 14: 47,733,243 N1192S probably benign Het
Ldha G A 7: 46,853,993 V270M probably damaging Het
Lyst T C 13: 13,757,306 probably benign Het
Map3k9 A T 12: 81,722,482 F954I probably benign Het
Mroh2b A G 15: 4,934,395 N823S probably damaging Het
Mycbp2 A T 14: 103,182,459 N2480K probably damaging Het
Nat1 A G 8: 67,491,325 K121E probably benign Het
Neurl1b T A 17: 26,441,545 probably null Het
Nnt C A 13: 119,394,721 L163F probably damaging Het
Olfr1417 A G 19: 11,828,192 V278A probably benign Het
Otog A G 7: 46,298,244 T2274A probably damaging Het
Pde4b G A 4: 102,602,651 R561Q probably damaging Het
Pitpnm2 A G 5: 124,131,201 F453L probably damaging Het
Pms1 T C 1: 53,196,813 probably null Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Prdx6b A G 2: 80,293,315 N156S probably damaging Het
Ptpn9 A G 9: 57,061,133 S586G probably benign Het
Serpina6 A T 12: 103,651,794 N253K probably damaging Het
Slc12a2 T A 18: 57,919,536 V809D possibly damaging Het
Slc2a8 C T 2: 32,973,684 A449T probably benign Het
Slc6a6 A G 6: 91,724,958 I116V probably null Het
Synj2 T A 17: 6,008,105 S58R possibly damaging Het
Tktl2 T C 8: 66,513,179 V463A probably damaging Het
Uchl5 T C 1: 143,794,344 V105A possibly damaging Het
Usp9y T C Y: 1,333,600 probably benign Het
Vmn1r200 T C 13: 22,395,497 S148P probably damaging Het
Vmn2r50 A T 7: 10,047,717 M367K possibly damaging Het
Vps13a T C 19: 16,655,206 probably benign Het
Wdr26 A T 1: 181,186,070 probably null Het
Ythdc2 T A 18: 44,850,398 M544K probably damaging Het
Other mutations in Clmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Clmp APN 9 40782610 makesense probably null
IGL01783:Clmp APN 9 40782407 missense possibly damaging 0.91
IGL02565:Clmp APN 9 40772415 missense probably damaging 1.00
IGL02953:Clmp APN 9 40774387 missense probably damaging 1.00
IGL02976:Clmp APN 9 40781224 missense possibly damaging 0.92
IGL03357:Clmp APN 9 40686327 utr 5 prime probably benign
IGL03383:Clmp APN 9 40774441 missense probably damaging 1.00
R0539:Clmp UTSW 9 40782486 missense probably benign 0.00
R1453:Clmp UTSW 9 40782441 missense probably damaging 0.98
R1623:Clmp UTSW 9 40782560 missense probably benign
R2899:Clmp UTSW 9 40782392 missense probably damaging 1.00
R4175:Clmp UTSW 9 40771136 missense probably benign 0.04
R5570:Clmp UTSW 9 40772530 critical splice donor site probably null
R6048:Clmp UTSW 9 40771109 missense probably damaging 1.00
R6240:Clmp UTSW 9 40782411 missense probably damaging 1.00
R6551:Clmp UTSW 9 40771277 missense probably benign
R7216:Clmp UTSW 9 40760909 missense possibly damaging 0.62
R8179:Clmp UTSW 9 40781179 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGCATCTGCATTGCTCATTAGAGGG -3'
(R):5'- GCATCAAGCTGCTGCATCTTAGCC -3'

Sequencing Primer
(F):5'- CATTGCTCATTAGAGGGTTTCC -3'
(R):5'- agttcttattgcccgtgcc -3'
Posted On2013-06-12