Incidental Mutation 'R0530:Dclk3'
ID 49114
Institutional Source Beutler Lab
Gene Symbol Dclk3
Ensembl Gene ENSMUSG00000032500
Gene Name doublecortin-like kinase 3
Synonyms Click-I, -II related, Dcamkl3
MMRRC Submission 038722-MU
Accession Numbers

Genbank: NM_172928; MGI: 3039580

Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock # R0530 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 111439081-111489118 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111482721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 677 (Y677F)
Ref Sequence ENSEMBL: ENSMUSP00000107510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111879]
AlphaFold Q8BWQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000111879
AA Change: Y677F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107510
Gene: ENSMUSG00000032500
AA Change: Y677F

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:DCX 115 177 2.9e-17 PFAM
low complexity region 200 218 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
S_TKc 514 771 1.63e-110 SMART
Meta Mutation Damage Score 0.2787 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. Differently from the other two closely related family members (DCLK1 and DCLK2), the protein encoded by this gene contains only one N-terminal doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. The protein contains a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,530,120 noncoding transcript Het
Abcg3 A G 5: 104,936,054 W617R probably damaging Het
Cep83 A T 10: 94,719,588 probably benign Het
Ces1e G A 8: 93,219,521 probably benign Het
Ckap2 A G 8: 22,175,972 probably benign Het
Clip1 C A 5: 123,640,531 R443L probably damaging Het
Clmp A G 9: 40,761,006 D44G probably benign Het
Cntnap2 G A 6: 46,529,905 Q304* probably null Het
Cst7 A T 2: 150,570,515 probably benign Het
Dlat G T 9: 50,637,569 N562K probably damaging Het
Elmod1 A T 9: 53,925,976 Y182N probably damaging Het
Fam19a3 T C 3: 104,772,171 probably benign Het
Fzd10 T C 5: 128,602,013 F266L probably damaging Het
Gm5346 A T 8: 43,626,531 C219S probably benign Het
Gm7534 A G 4: 134,202,910 I28T probably benign Het
Gm8258 A G 5: 104,776,086 noncoding transcript Het
Gm9742 T A 13: 8,030,005 noncoding transcript Het
Hdlbp T C 1: 93,430,317 probably benign Het
Itga8 A G 2: 12,191,816 S597P probably damaging Het
Kndc1 A T 7: 139,901,237 I80F probably damaging Het
Ktn1 A G 14: 47,733,243 N1192S probably benign Het
Ldha G A 7: 46,853,993 V270M probably damaging Het
Lyst T C 13: 13,757,306 probably benign Het
Map3k9 A T 12: 81,722,482 F954I probably benign Het
Mroh2b A G 15: 4,934,395 N823S probably damaging Het
Mycbp2 A T 14: 103,182,459 N2480K probably damaging Het
Nat1 A G 8: 67,491,325 K121E probably benign Het
Neurl1b T A 17: 26,441,545 probably null Het
Nnt C A 13: 119,394,721 L163F probably damaging Het
Olfr1417 A G 19: 11,828,192 V278A probably benign Het
Otog A G 7: 46,298,244 T2274A probably damaging Het
Pde4b G A 4: 102,602,651 R561Q probably damaging Het
Pitpnm2 A G 5: 124,131,201 F453L probably damaging Het
Pms1 T C 1: 53,196,813 probably null Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Prdx6b A G 2: 80,293,315 N156S probably damaging Het
Ptpn9 A G 9: 57,061,133 S586G probably benign Het
Serpina6 A T 12: 103,651,794 N253K probably damaging Het
Slc12a2 T A 18: 57,919,536 V809D possibly damaging Het
Slc2a8 C T 2: 32,973,684 A449T probably benign Het
Slc6a6 A G 6: 91,724,958 I116V probably null Het
Synj2 T A 17: 6,008,105 S58R possibly damaging Het
Tktl2 T C 8: 66,513,179 V463A probably damaging Het
Uchl5 T C 1: 143,794,344 V105A possibly damaging Het
Usp9y T C Y: 1,333,600 probably benign Het
Vmn1r200 T C 13: 22,395,497 S148P probably damaging Het
Vmn2r50 A T 7: 10,047,717 M367K possibly damaging Het
Vps13a T C 19: 16,655,206 probably benign Het
Wdr26 A T 1: 181,186,070 probably null Het
Ythdc2 T A 18: 44,850,398 M544K probably damaging Het
Other mutations in Dclk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Dclk3 APN 9 111467843 nonsense probably null
IGL02125:Dclk3 APN 9 111469107 missense probably damaging 1.00
IGL02547:Dclk3 APN 9 111469023 missense probably damaging 1.00
IGL03393:Dclk3 APN 9 111488673 utr 3 prime probably benign
G1citation:Dclk3 UTSW 9 111439337 missense probably benign 0.03
IGL02984:Dclk3 UTSW 9 111488575 missense probably damaging 1.00
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0432:Dclk3 UTSW 9 111484935 missense probably damaging 1.00
R0440:Dclk3 UTSW 9 111469163 missense probably damaging 1.00
R1024:Dclk3 UTSW 9 111469070 missense possibly damaging 0.95
R1443:Dclk3 UTSW 9 111469020 missense probably benign 0.01
R1474:Dclk3 UTSW 9 111469236 missense probably benign 0.43
R1479:Dclk3 UTSW 9 111468546 missense probably benign
R1482:Dclk3 UTSW 9 111467820 missense possibly damaging 0.90
R1543:Dclk3 UTSW 9 111468054 missense probably benign 0.04
R1552:Dclk3 UTSW 9 111488579 missense probably damaging 1.00
R1559:Dclk3 UTSW 9 111469208 missense probably damaging 1.00
R2011:Dclk3 UTSW 9 111468354 missense probably benign 0.00
R2369:Dclk3 UTSW 9 111488542 missense probably benign 0.16
R4111:Dclk3 UTSW 9 111469080 missense probably damaging 0.99
R4510:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4511:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4592:Dclk3 UTSW 9 111467895 missense probably damaging 1.00
R4604:Dclk3 UTSW 9 111469185 missense probably damaging 1.00
R4857:Dclk3 UTSW 9 111468648 missense probably benign
R4932:Dclk3 UTSW 9 111468042 missense possibly damaging 0.56
R5045:Dclk3 UTSW 9 111467788 missense probably damaging 0.99
R5233:Dclk3 UTSW 9 111468681 missense probably benign
R5338:Dclk3 UTSW 9 111469059 missense possibly damaging 0.95
R5463:Dclk3 UTSW 9 111469260 missense probably benign 0.26
R6822:Dclk3 UTSW 9 111439337 missense probably benign 0.03
R6995:Dclk3 UTSW 9 111467700 missense possibly damaging 0.88
R7187:Dclk3 UTSW 9 111484996 missense probably damaging 1.00
R7532:Dclk3 UTSW 9 111467528 missense probably benign 0.03
R7534:Dclk3 UTSW 9 111468218 missense probably benign
R7734:Dclk3 UTSW 9 111469095 missense probably damaging 1.00
R8326:Dclk3 UTSW 9 111467534 missense probably damaging 0.96
R8372:Dclk3 UTSW 9 111485013 missense probably damaging 0.98
R8388:Dclk3 UTSW 9 111482745 missense probably damaging 1.00
R8423:Dclk3 UTSW 9 111468719 missense possibly damaging 0.93
R8493:Dclk3 UTSW 9 111468147 missense probably benign 0.06
R9013:Dclk3 UTSW 9 111468498 missense probably benign 0.31
R9114:Dclk3 UTSW 9 111488615 missense probably benign 0.06
R9338:Dclk3 UTSW 9 111439305 missense unknown
R9412:Dclk3 UTSW 9 111482751 critical splice donor site probably null
X0020:Dclk3 UTSW 9 111485075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTGTCCCTGGTTGCACACA -3'
(R):5'- GGCCTTCGTTGAGTAGATTTCTCCC -3'

Sequencing Primer
(F):5'- cacacacacacacacacaac -3'
(R):5'- ggggaggggggagagag -3'
Posted On 2013-06-12