Incidental Mutation 'R0531:Tmem81'
ID49133
Institutional Source Beutler Lab
Gene Symbol Tmem81
Ensembl Gene ENSMUSG00000048174
Gene Nametransmembrane protein 81
Synonyms4930429O20Rik
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132506230-132508639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 132507829 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 124 (I124M)
Ref Sequence ENSEMBL: ENSMUSP00000139911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000058167] [ENSMUST00000086521] [ENSMUST00000187505] [ENSMUST00000188789] [ENSMUST00000190825] [ENSMUST00000190997]
Predicted Effect probably benign
Transcript: ENSMUST00000027700
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058167
AA Change: I124M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062565
Gene: ENSMUSG00000048174
AA Change: I124M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086521
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186487
Predicted Effect probably benign
Transcript: ENSMUST00000187505
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187834
Predicted Effect probably benign
Transcript: ENSMUST00000188065
Predicted Effect probably damaging
Transcript: ENSMUST00000188789
AA Change: I124M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139911
Gene: ENSMUSG00000048174
AA Change: I124M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190601
Predicted Effect probably benign
Transcript: ENSMUST00000190825
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190997
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Tmem81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Tmem81 APN 1 132507960 missense probably damaging 1.00
R0094:Tmem81 UTSW 1 132508049 missense probably benign 0.00
R0255:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0432:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0532:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0551:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0614:Tmem81 UTSW 1 132507731 missense probably benign 0.01
R0651:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0696:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0973:Tmem81 UTSW 1 132507924 missense probably damaging 1.00
R1663:Tmem81 UTSW 1 132507897 missense probably benign 0.05
R1750:Tmem81 UTSW 1 132507583 missense probably damaging 0.98
R1881:Tmem81 UTSW 1 132508210 unclassified probably benign
R2074:Tmem81 UTSW 1 132507906 missense probably damaging 0.98
R2121:Tmem81 UTSW 1 132508109 missense probably benign 0.00
R3003:Tmem81 UTSW 1 132508014 missense probably benign 0.38
R3789:Tmem81 UTSW 1 132508071 missense probably benign 0.03
R4638:Tmem81 UTSW 1 132508205 unclassified probably benign
R7162:Tmem81 UTSW 1 132507617 missense probably damaging 1.00
R7375:Tmem81 UTSW 1 132507563 missense possibly damaging 0.76
R7527:Tmem81 UTSW 1 132508146 missense probably benign 0.34
R7586:Tmem81 UTSW 1 132507773 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAATGCCACAGGATGCAGTGTTAC -3'
(R):5'- ACAATTCCTATGCCCAAGGCCG -3'

Sequencing Primer
(F):5'- TGGCCTTGGCTACAAGGAAG -3'
(R):5'- ACTTCTGATCCTCAGTAAGGGAC -3'
Posted On2013-06-12