Incidental Mutation 'R0531:Bcar3'
ID49145
Institutional Source Beutler Lab
Gene Symbol Bcar3
Ensembl Gene ENSMUSG00000028121
Gene Namebreast cancer anti-estrogen resistance 3
SynonymsAND-34
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.699) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122294136-122530191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122426499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 15 (V15A)
Ref Sequence ENSEMBL: ENSMUSP00000029766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029766]
Predicted Effect probably benign
Transcript: ENSMUST00000029766
AA Change: V15A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029766
Gene: ENSMUSG00000028121
AA Change: V15A

DomainStartEndE-ValueType
low complexity region 126 145 N/A INTRINSIC
SH2 146 234 3.17e-21 SMART
low complexity region 395 406 N/A INTRINSIC
RasGEF 539 814 2.55e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200544
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breast tumors are initially dependent on estrogens for growth and progression and can be inhibited by anti-estrogens such as tamoxifen. However, breast cancers progress to become anti-estrogen resistant. Breast cancer anti-estrogen resistance gene 3 was identified in the search for genes involved in the development of estrogen resistance. The gene encodes a component of intracellular signal transduction that causes estrogen-independent proliferation in human breast cancer cells. The protein contains a putative src homology 2 (SH2) domain, a hall mark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cataracts due to rupture of the lens capsule and liquefaction of lens cortical fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Bcar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Bcar3 APN 3 122512936 missense probably benign 0.36
IGL01372:Bcar3 APN 3 122523294 missense probably damaging 1.00
IGL02681:Bcar3 APN 3 122512768 unclassified probably null
IGL03403:Bcar3 APN 3 122512969 missense probably benign 0.01
R0408:Bcar3 UTSW 3 122508384 missense probably damaging 0.98
R0798:Bcar3 UTSW 3 122525299 missense probably benign 0.01
R1445:Bcar3 UTSW 3 122523191 missense probably damaging 0.98
R1892:Bcar3 UTSW 3 122508136 missense probably benign 0.00
R2138:Bcar3 UTSW 3 122512996 missense probably damaging 1.00
R3236:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3237:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3832:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R4801:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R4802:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R5342:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R5364:Bcar3 UTSW 3 122529632 missense probably benign 0.41
R5560:Bcar3 UTSW 3 122426575 missense possibly damaging 0.92
R5714:Bcar3 UTSW 3 122455087 missense possibly damaging 0.88
R5716:Bcar3 UTSW 3 122512915 missense probably damaging 1.00
R5944:Bcar3 UTSW 3 122523283 missense probably benign
R6478:Bcar3 UTSW 3 122426576 missense probably benign 0.04
R6615:Bcar3 UTSW 3 122426633 missense probably benign 0.00
R6996:Bcar3 UTSW 3 122508384 missense possibly damaging 0.95
R7272:Bcar3 UTSW 3 122508396 missense possibly damaging 0.92
R7308:Bcar3 UTSW 3 122508493 missense probably benign 0.00
R7353:Bcar3 UTSW 3 122512692 missense probably benign 0.00
R7465:Bcar3 UTSW 3 122523230 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGTTTGGATTTGCTACCCATCCAGC -3'
(R):5'- TGACTTTTCTCGCAGGACGTGAC -3'

Sequencing Primer
(F):5'- aaagggagagagagagagagag -3'
(R):5'- ACCTGAAGATGAAGTTTTCCCC -3'
Posted On2013-06-12