Incidental Mutation 'R0531:Cenpa'
ID49149
Institutional Source Beutler Lab
Gene Symbol Cenpa
Ensembl Gene ENSMUSG00000029177
Gene Namecentromere protein A
Synonymscentrosomin A, Cenp-A
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0531 (G1)
Quality Score209
Status Validated
Chromosome5
Chromosomal Location30666777-30674830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30672493 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 39 (F39L)
Ref Sequence ENSEMBL: ENSMUSP00000143575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031073] [ENSMUST00000133316] [ENSMUST00000134846] [ENSMUST00000144742] [ENSMUST00000149759] [ENSMUST00000199320] [ENSMUST00000199617]
Predicted Effect probably benign
Transcript: ENSMUST00000031073
Predicted Effect probably benign
Transcript: ENSMUST00000133316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134372
Predicted Effect probably benign
Transcript: ENSMUST00000134846
Predicted Effect probably benign
Transcript: ENSMUST00000144742
AA Change: F39L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122831
Gene: ENSMUSG00000029177
AA Change: F39L

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
H3 28 131 5.22e-66 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149759
SMART Domains Protein: ENSMUSP00000142915
Gene: ENSMUSG00000029177

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197962
Predicted Effect possibly damaging
Transcript: ENSMUST00000199320
AA Change: F39L

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143575
Gene: ENSMUSG00000029177
AA Change: F39L

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
H3 28 97 2.6e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199617
AA Change: F39L

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142917
Gene: ENSMUSG00000029177
AA Change: F39L

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
H3 28 129 1.5e-22 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. This gene encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. Centromere protein A is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle. The protein is a replication-independent histone that is a member of the histone H3 family. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5 and E10.5. Embryogenesis is impaired due to chromosomal missegregation, aneuploidy, and apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Cenpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5638:Cenpa UTSW 5 30673392 missense probably damaging 1.00
R5935:Cenpa UTSW 5 30673037 missense possibly damaging 0.91
R6923:Cenpa UTSW 5 30672462 critical splice acceptor site probably null
R7438:Cenpa UTSW 5 30666948 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCCAAGGCTCCAGGGTAATCAAG -3'
(R):5'- AGCCACATCAGTGAGATGCACAAG -3'

Sequencing Primer
(F):5'- tgtactagatactcctaattccttcc -3'
(R):5'- AAGCATCCTGCACATTTGGG -3'
Posted On2013-06-12