Incidental Mutation 'R0531:Olfr146'
ID49165
Institutional Source Beutler Lab
Gene Symbol Olfr146
Ensembl Gene ENSMUSG00000058820
Gene Nameolfactory receptor 146
SynonymsGA_x6K02T2PVTD-32715386-32714466, MOR171-10, M15
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39018073-39023377 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39019176 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 122 (R122S)
Ref Sequence ENSEMBL: ENSMUSP00000149294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073671] [ENSMUST00000214369] [ENSMUST00000214410] [ENSMUST00000215383]
Predicted Effect probably damaging
Transcript: ENSMUST00000073671
AA Change: R122S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073352
Gene: ENSMUSG00000058820
AA Change: R122S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.6e-54 PFAM
Pfam:7tm_1 41 290 8.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214369
Predicted Effect probably damaging
Transcript: ENSMUST00000214410
AA Change: R122S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215383
AA Change: R122S

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Olfr146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Olfr146 APN 9 39018801 missense probably damaging 0.98
IGL01655:Olfr146 APN 9 39018918 missense probably benign 0.00
IGL01804:Olfr146 APN 9 39019401 missense probably benign 0.13
IGL02098:Olfr146 APN 9 39018891 missense probably damaging 1.00
IGL02719:Olfr146 APN 9 39019016 missense probably benign 0.11
R1270:Olfr146 UTSW 9 39019247 missense possibly damaging 0.90
R1511:Olfr146 UTSW 9 39019025 missense probably benign 0.03
R1590:Olfr146 UTSW 9 39018957 missense probably benign 0.09
R1649:Olfr146 UTSW 9 39019480 missense probably benign 0.03
R3419:Olfr146 UTSW 9 39019076 missense probably benign 0.03
R4669:Olfr146 UTSW 9 39019379 missense probably benign 0.10
R4788:Olfr146 UTSW 9 39018921 missense probably benign 0.07
R5184:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R5581:Olfr146 UTSW 9 39018702 missense probably damaging 0.98
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6032:Olfr146 UTSW 9 39018965 missense probably benign 0.00
R6319:Olfr146 UTSW 9 39019514 missense probably damaging 1.00
R6626:Olfr146 UTSW 9 39019106 missense possibly damaging 0.63
R6693:Olfr146 UTSW 9 39018801 missense probably damaging 0.98
R7165:Olfr146 UTSW 9 39023270 start gained probably benign
Z1088:Olfr146 UTSW 9 39018789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTCAGATACGTAAATCCAGCAGAG -3'
(R):5'- CTTGGAATCTACCTGCTCACAGTGC -3'

Sequencing Primer
(F):5'- CCCTCAGTGGATTTAATGCGTAG -3'
(R):5'- TCAGCTCGTACCTGCACAC -3'
Posted On2013-06-12