Incidental Mutation 'R0531:Senp6'
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene NameSUMO/sentrin specific peptidase 6
SynonymsE130319N12Rik, 2810017C20Rik
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosomal Location80066903-80144953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80123884 bp
Amino Acid Change Threonine to Alanine at position 623 (T623A)
Ref Sequence ENSEMBL: ENSMUSP00000126777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176360] [ENSMUST00000176527]
Predicted Effect probably damaging
Transcript: ENSMUST00000037484
AA Change: T616A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: T616A

low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164859
AA Change: T450A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252
AA Change: T450A

ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165458
Predicted Effect probably damaging
Transcript: ENSMUST00000165607
AA Change: T623A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: T623A

low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175910
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect probably benign
Transcript: ENSMUST00000176360
Predicted Effect probably damaging
Transcript: ENSMUST00000176527
AA Change: T30A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135719
Gene: ENSMUSG00000034252
AA Change: T30A

Pfam:Peptidase_C48 114 165 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176607
SMART Domains Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 4.9e-23 PFAM
Pfam:Peptidase_C48 799 911 2.1e-14 PFAM
Meta Mutation Damage Score 0.2099 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80116610 missense probably damaging 1.00
IGL00487:Senp6 APN 9 80113838 missense probably damaging 1.00
IGL01285:Senp6 APN 9 80136718 missense probably benign 0.05
IGL01337:Senp6 APN 9 80136510 missense probably damaging 0.97
IGL01563:Senp6 APN 9 80122008 missense probably benign
IGL01633:Senp6 APN 9 80092394 missense probably damaging 1.00
IGL02115:Senp6 APN 9 80121926 missense probably damaging 1.00
IGL02208:Senp6 APN 9 80113943 missense probably damaging 1.00
IGL02378:Senp6 APN 9 80126392 missense probably damaging 1.00
A4554:Senp6 UTSW 9 80148458 unclassified probably benign
R0031:Senp6 UTSW 9 80126243 missense probably damaging 1.00
R0121:Senp6 UTSW 9 80116670 missense probably benign 0.01
R0276:Senp6 UTSW 9 80136747 missense probably benign
R0294:Senp6 UTSW 9 80113725 splice site probably null
R0308:Senp6 UTSW 9 80132983 critical splice donor site probably null
R0743:Senp6 UTSW 9 80093589 missense probably damaging 1.00
R0883:Senp6 UTSW 9 80116559 missense probably damaging 1.00
R1071:Senp6 UTSW 9 80136729 missense probably benign 0.35
R1171:Senp6 UTSW 9 80116725 missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80122023 missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80093571 missense probably damaging 1.00
R1760:Senp6 UTSW 9 80118629 missense probably benign 0.36
R1909:Senp6 UTSW 9 80113774 missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80126398 missense probably damaging 1.00
R2067:Senp6 UTSW 9 80089869 missense probably benign 0.11
R2077:Senp6 UTSW 9 80126155 missense probably benign 0.14
R2141:Senp6 UTSW 9 80123820 missense probably damaging 1.00
R2321:Senp6 UTSW 9 80123740 missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80121978 missense probably null
R2939:Senp6 UTSW 9 80143842 missense probably benign 0.00
R2940:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3081:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3784:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3785:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3800:Senp6 UTSW 9 80087453 missense possibly damaging 0.89
R3857:Senp6 UTSW 9 80092321 missense possibly damaging 0.85
R4790:Senp6 UTSW 9 80089858 missense probably benign 0.20
R5117:Senp6 UTSW 9 80130746 missense probably damaging 1.00
R5418:Senp6 UTSW 9 80121869 missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80143843 missense probably damaging 1.00
R5582:Senp6 UTSW 9 80089876 missense possibly damaging 0.91
R5717:Senp6 UTSW 9 80092312 missense probably damaging 0.99
R5800:Senp6 UTSW 9 80126433 missense probably damaging 1.00
R5802:Senp6 UTSW 9 80118644 unclassified probably benign
R5899:Senp6 UTSW 9 80142070 splice site probably benign
R5918:Senp6 UTSW 9 80114116 critical splice donor site probably null
R5958:Senp6 UTSW 9 80142294 missense probably damaging 1.00
R6360:Senp6 UTSW 9 80113806 missense probably benign
R6477:Senp6 UTSW 9 80093625 nonsense probably null
R6628:Senp6 UTSW 9 80132954 missense probably damaging 1.00
R6703:Senp6 UTSW 9 80121921 missense probably damaging 1.00
R7236:Senp6 UTSW 9 80132965 missense probably damaging 1.00
R7268:Senp6 UTSW 9 80142124 missense probably damaging 1.00
R7290:Senp6 UTSW 9 80136515 missense probably benign 0.25
R7319:Senp6 UTSW 9 80126199 missense probably damaging 1.00
R7422:Senp6 UTSW 9 80113877 missense probably damaging 1.00
R7474:Senp6 UTSW 9 80142328 missense probably damaging 1.00
R7480:Senp6 UTSW 9 80121917 missense probably damaging 1.00
R7491:Senp6 UTSW 9 80123728 nonsense probably null
R8428:Senp6 UTSW 9 80118512 missense probably damaging 1.00
R8920:Senp6 UTSW 9 80092279 missense probably benign 0.06
Z1176:Senp6 UTSW 9 80142266 missense probably benign 0.02
Z1177:Senp6 UTSW 9 80103693 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgcctaacaagtgtggaagtc -3'
Posted On2013-06-12