Mutagenetix > Incidental Mutation

Incidental Mutation 'R0531:Senp6'

49169

Institutional Source

Beutler Lab

Gene Symbol

Senp6

Ensembl Gene

ENSMUSG00000034252

Gene Name

SUMO/sentrin specific peptidase 6

Synonyms

E130319N12Rik, 2810017C20Rik

MMRRC Submission

038723-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0531 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80066903-80144953 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80123884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 623 (T623A)

Ref Sequence

ENSEMBL: ENSMUSP00000126777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176360] [ENSMUST00000176527]

AlphaFold

Q6P7W0

Predicted Effect

probably damaging
Transcript: ENSMUST00000037484
AA Change: T616A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: T616A

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
ZnF_C2HC	242	260	7.23e0	SMART
Pfam:Peptidase_C48	700	826	3.5e-23	PFAM
Pfam:Peptidase_C48	965	1096	1.1e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164859
AA Change: T450A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252
AA Change: T450A

Domain	Start	End	E-Value	Type
ZnF_C2HC	76	94	7.23e0	SMART
Pfam:Peptidase_C48	534	660	5.2e-23	PFAM
Pfam:Peptidase_C48	799	930	1.6e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165458

Predicted Effect

probably damaging
Transcript: ENSMUST00000165607
AA Change: T623A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: T623A

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
ZnF_C2HC	249	267	7.23e0	SMART
Pfam:Peptidase_C48	707	833	3.4e-23	PFAM
Pfam:Peptidase_C48	972	1103	1.1e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175910

Predicted Effect

probably benign
Transcript: ENSMUST00000175999

Predicted Effect

probably benign
Transcript: ENSMUST00000176360

Predicted Effect

probably damaging
Transcript: ENSMUST00000176527
AA Change: T30A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135719
Gene: ENSMUSG00000034252
AA Change: T30A

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C48	114	165	6.5e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176607

SMART Domains

Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

Domain	Start	End	E-Value	Type
ZnF_C2HC	76	94	7.23e0	SMART
Pfam:Peptidase_C48	534	660	4.9e-23	PFAM
Pfam:Peptidase_C48	799	911	2.1e-14	PFAM

Meta Mutation Damage Score

0.2099

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,915,146	N130D	probably benign	Het
4932438A13Rik	T	A	3: 37,036,825	I743N	probably damaging	Het
Acot6	C	A	12: 84,101,301	D110E	probably benign	Het
Agrn	T	A	4: 156,179,434	N124I	probably benign	Het
Astn1	G	T	1: 158,600,389	G710V	probably damaging	Het
Bcar3	T	C	3: 122,426,499	V15A	probably benign	Het
Best3	T	C	10: 117,004,375		probably benign	Het
Cenpa	T	C	5: 30,672,493	F39L	possibly damaging	Het
Cfap44	A	T	16: 44,401,426	M1L	probably benign	Het
Chrnd	A	G	1: 87,194,819	I107M	probably damaging	Het
Col11a2	A	G	17: 34,058,377		probably benign	Het
Dnah10	G	A	5: 124,812,723		probably null	Het
Entpd8	A	G	2: 25,084,769	Y404C	probably damaging	Het
Fam118a	T	C	15: 85,048,432	I125T	possibly damaging	Het
Fam129a	T	C	1: 151,718,084	V840A	probably benign	Het
Fam161a	G	A	11: 23,020,298	E159K	possibly damaging	Het
Fkbp5	A	T	17: 28,438,029	H71Q	probably benign	Het
Frem2	A	T	3: 53,519,954	Y2926N	probably damaging	Het
Gap43	A	T	16: 42,292,328	D23E	probably damaging	Het
Glt8d1	T	C	14: 31,006,504	F3S	probably benign	Het
Gm11555	C	T	11: 99,650,018		probably benign	Het
Gtpbp1	G	A	15: 79,720,091	G667S	probably damaging	Het
H2-T24	A	C	17: 36,015,571	S145R	probably benign	Het
Inpp5b	A	T	4: 124,795,456	N843I	probably damaging	Het
Jak3	C	T	8: 71,686,976		probably benign	Het
Krt8	T	A	15: 102,001,448	M174L	probably benign	Het
Ktn1	C	T	14: 47,663,941	T52I	probably damaging	Het
Lrp4	T	C	2: 91,475,178		probably benign	Het
Nefh	G	A	11: 4,940,240	A793V	probably damaging	Het
Notch1	A	G	2: 26,466,572	S1678P	probably benign	Het
Notch2	C	T	3: 98,102,451		probably benign	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1346	A	T	7: 6,474,235	I42F	possibly damaging	Het
Olfr146	G	T	9: 39,019,176	R122S	probably damaging	Het
Olfr1504	C	T	19: 13,887,752	V153I	possibly damaging	Het
Olfr209	T	A	16: 59,361,808	N137Y	probably damaging	Het
Olfr324	A	G	11: 58,597,848	I151V	probably benign	Het
Olfr961	A	G	9: 39,646,872	T49A	probably benign	Het
Pak4	T	A	7: 28,568,054	I62F	possibly damaging	Het
Pcdhb12	T	A	18: 37,437,318	F506I	probably damaging	Het
Per1	A	T	11: 69,104,190	D632V	probably damaging	Het
Plec	A	G	15: 76,177,298	M2678T	probably benign	Het
Plg	A	G	17: 12,411,447		probably benign	Het
Prmt1	A	T	7: 44,977,624	S304R	probably damaging	Het
Prr27	T	C	5: 87,842,678	F50L	probably benign	Het
Prune2	T	C	19: 17,006,753	L159P	probably damaging	Het
Ptpn12	A	T	5: 20,998,483	N432K	possibly damaging	Het
Rfwd3	A	G	8: 111,293,989		probably null	Het
Rims2	A	T	15: 39,567,030	D1170V	probably damaging	Het
Sag	T	C	1: 87,834,629		probably null	Het
Sall4	C	T	2: 168,756,336	A195T	probably benign	Het
Sbf2	G	A	7: 110,367,323		probably benign	Het
Scaper	A	T	9: 55,609,874	D599E	possibly damaging	Het
Sema7a	G	A	9: 57,960,593	S484N	possibly damaging	Het
Senp1	A	G	15: 98,064,880		probably benign	Het
Siae	A	G	9: 37,627,794	D95G	probably benign	Het
Slc26a2	T	C	18: 61,198,379	D660G	probably damaging	Het
Slc3a1	T	C	17: 85,028,649	F73S	possibly damaging	Het
Slfn5	A	T	11: 82,961,040	Q664L	probably damaging	Het
Spire1	T	C	18: 67,491,305	I512V	probably damaging	Het
Srpr	A	G	9: 35,213,501	T133A	probably benign	Het
Stag1	A	G	9: 100,954,247	*175W	probably null	Het
Stk32c	C	A	7: 139,120,720	V316F	probably damaging	Het
Tekt1	A	C	11: 72,345,594	N347K	possibly damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tnpo2	T	A	8: 85,050,157	C498S	probably damaging	Het
Tra2b	G	A	16: 22,247,205	R281*	probably null	Het
Ubr5	A	T	15: 37,991,344	I1985N	probably benign	Het
Ush2a	T	G	1: 188,443,181	S1159A	probably benign	Het
Vmn1r15	C	T	6: 57,258,251	P35S	probably benign	Het
Vmn1r6	A	T	6: 57,002,598	I60L	probably benign	Het
Vps8	A	G	16: 21,459,811		probably benign	Het
Xkr7	T	C	2: 153,032,352	V113A	possibly damaging	Het

Other mutations in Senp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Senp6	APN	9	80116610	missense	probably damaging	1.00
IGL00487:Senp6	APN	9	80113838	missense	probably damaging	1.00
IGL01285:Senp6	APN	9	80136718	missense	probably benign	0.05
IGL01337:Senp6	APN	9	80136510	missense	probably damaging	0.97
IGL01563:Senp6	APN	9	80122008	missense	probably benign
IGL01633:Senp6	APN	9	80092394	missense	probably damaging	1.00
IGL02115:Senp6	APN	9	80121926	missense	probably damaging	1.00
IGL02208:Senp6	APN	9	80113943	missense	probably damaging	1.00
IGL02378:Senp6	APN	9	80126392	missense	probably damaging	1.00
A4554:Senp6	UTSW	9	80148458	unclassified	probably benign
R0031:Senp6	UTSW	9	80126243	missense	probably damaging	1.00
R0121:Senp6	UTSW	9	80116670	missense	probably benign	0.01
R0276:Senp6	UTSW	9	80136747	missense	probably benign
R0294:Senp6	UTSW	9	80113725	splice site	probably null
R0308:Senp6	UTSW	9	80132983	critical splice donor site	probably null
R0743:Senp6	UTSW	9	80093589	missense	probably damaging	1.00
R0883:Senp6	UTSW	9	80116559	missense	probably damaging	1.00
R1071:Senp6	UTSW	9	80136729	missense	probably benign	0.35
R1171:Senp6	UTSW	9	80116725	missense	possibly damaging	0.89
R1340:Senp6	UTSW	9	80122023	missense	possibly damaging	0.47
R1571:Senp6	UTSW	9	80093571	missense	probably damaging	1.00
R1760:Senp6	UTSW	9	80118629	missense	probably benign	0.36
R1909:Senp6	UTSW	9	80113774	missense	possibly damaging	0.67
R2008:Senp6	UTSW	9	80126398	missense	probably damaging	1.00
R2067:Senp6	UTSW	9	80089869	missense	probably benign	0.11
R2077:Senp6	UTSW	9	80126155	missense	probably benign	0.14
R2141:Senp6	UTSW	9	80123820	missense	probably damaging	1.00
R2321:Senp6	UTSW	9	80123740	missense	possibly damaging	0.83
R2760:Senp6	UTSW	9	80121978	missense	probably null
R2939:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R2940:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R3081:Senp6	UTSW	9	80143842	missense	probably benign	0.00
R3784:Senp6	UTSW	9	80092286	missense	probably benign	0.16
R3785:Senp6	UTSW	9	80092286	missense	probably benign	0.16
R3800:Senp6	UTSW	9	80087453	missense	possibly damaging	0.89
R3857:Senp6	UTSW	9	80092321	missense	possibly damaging	0.85
R4790:Senp6	UTSW	9	80089858	missense	probably benign	0.20
R5117:Senp6	UTSW	9	80130746	missense	probably damaging	1.00
R5418:Senp6	UTSW	9	80121869	missense	possibly damaging	0.89
R5477:Senp6	UTSW	9	80143843	missense	probably damaging	1.00
R5582:Senp6	UTSW	9	80089876	missense	possibly damaging	0.91
R5717:Senp6	UTSW	9	80092312	missense	probably damaging	0.99
R5800:Senp6	UTSW	9	80126433	missense	probably damaging	1.00
R5802:Senp6	UTSW	9	80118644	unclassified	probably benign
R5899:Senp6	UTSW	9	80142070	splice site	probably benign
R5918:Senp6	UTSW	9	80114116	critical splice donor site	probably null
R5958:Senp6	UTSW	9	80142294	missense	probably damaging	1.00
R6360:Senp6	UTSW	9	80113806	missense	probably benign
R6477:Senp6	UTSW	9	80093625	nonsense	probably null
R6628:Senp6	UTSW	9	80132954	missense	probably damaging	1.00
R6703:Senp6	UTSW	9	80121921	missense	probably damaging	1.00
R7236:Senp6	UTSW	9	80132965	missense	probably damaging	1.00
R7268:Senp6	UTSW	9	80142124	missense	probably damaging	1.00
R7290:Senp6	UTSW	9	80136515	missense	probably benign	0.25
R7319:Senp6	UTSW	9	80126199	missense	probably damaging	1.00
R7422:Senp6	UTSW	9	80113877	missense	probably damaging	1.00
R7474:Senp6	UTSW	9	80142328	missense	probably damaging	1.00
R7480:Senp6	UTSW	9	80121917	missense	probably damaging	1.00
R7491:Senp6	UTSW	9	80123728	nonsense	probably null
R8428:Senp6	UTSW	9	80118512	missense	probably damaging	1.00
R8920:Senp6	UTSW	9	80092279	missense	probably benign	0.06
R9158:Senp6	UTSW	9	80087450	missense	probably benign	0.03
R9300:Senp6	UTSW	9	80142151	missense	probably damaging	1.00
R9347:Senp6	UTSW	9	80139097	missense	possibly damaging	0.89
R9387:Senp6	UTSW	9	80092364	missense	probably damaging	1.00
R9521:Senp6	UTSW	9	80067405	start gained	probably benign
R9652:Senp6	UTSW	9	80113946	missense	probably damaging	1.00
R9794:Senp6	UTSW	9	80092308	missense	probably benign	0.04
Z1176:Senp6	UTSW	9	80142266	missense	probably benign	0.02
Z1177:Senp6	UTSW	9	80103693	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCGATTCAGTCTGTTCAGTTTCACAGC -3'
(R):5'- TGTGGCAAGGTCTGCCTAACAAG -3'

Sequencing Primer
(F):5'- ATCAGGCAGAGGTGGTCTTT -3'
(R):5'- tgcctaacaagtgtggaagtc -3'

Posted On

2013-06-12