Mutagenetix > Incidental Mutation

Incidental Mutation 'R0531:Best3'

49171

Institutional Source

Beutler Lab

Gene Symbol

Best3

Ensembl Gene

ENSMUSG00000020169

Gene Name

bestrophin 3

Synonyms

mBest4, Vmd2l3

MMRRC Submission

038723-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R0531 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

116986314-117025040 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 117004375 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000020378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020378]

AlphaFold

Q6H1V1

Predicted Effect

probably benign
Transcript: ENSMUST00000020378

SMART Domains

Protein: ENSMUSP00000020378
Gene: ENSMUSG00000020169

Domain	Start	End	E-Value	Type
Pfam:Bestrophin	8	316	7.3e-115	PFAM
low complexity region	405	416	N/A	INTRINSIC
low complexity region	473	492	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,915,146	N130D	probably benign	Het
4932438A13Rik	T	A	3: 37,036,825	I743N	probably damaging	Het
Acot6	C	A	12: 84,101,301	D110E	probably benign	Het
Agrn	T	A	4: 156,179,434	N124I	probably benign	Het
Astn1	G	T	1: 158,600,389	G710V	probably damaging	Het
Bcar3	T	C	3: 122,426,499	V15A	probably benign	Het
Cenpa	T	C	5: 30,672,493	F39L	possibly damaging	Het
Cfap44	A	T	16: 44,401,426	M1L	probably benign	Het
Chrnd	A	G	1: 87,194,819	I107M	probably damaging	Het
Col11a2	A	G	17: 34,058,377		probably benign	Het
Dnah10	G	A	5: 124,812,723		probably null	Het
Entpd8	A	G	2: 25,084,769	Y404C	probably damaging	Het
Fam118a	T	C	15: 85,048,432	I125T	possibly damaging	Het
Fam129a	T	C	1: 151,718,084	V840A	probably benign	Het
Fam161a	G	A	11: 23,020,298	E159K	possibly damaging	Het
Fkbp5	A	T	17: 28,438,029	H71Q	probably benign	Het
Frem2	A	T	3: 53,519,954	Y2926N	probably damaging	Het
Gap43	A	T	16: 42,292,328	D23E	probably damaging	Het
Glt8d1	T	C	14: 31,006,504	F3S	probably benign	Het
Gm11555	C	T	11: 99,650,018		probably benign	Het
Gtpbp1	G	A	15: 79,720,091	G667S	probably damaging	Het
H2-T24	A	C	17: 36,015,571	S145R	probably benign	Het
Inpp5b	A	T	4: 124,795,456	N843I	probably damaging	Het
Jak3	C	T	8: 71,686,976		probably benign	Het
Krt8	T	A	15: 102,001,448	M174L	probably benign	Het
Ktn1	C	T	14: 47,663,941	T52I	probably damaging	Het
Lrp4	T	C	2: 91,475,178		probably benign	Het
Nefh	G	A	11: 4,940,240	A793V	probably damaging	Het
Notch1	A	G	2: 26,466,572	S1678P	probably benign	Het
Notch2	C	T	3: 98,102,451		probably benign	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1346	A	T	7: 6,474,235	I42F	possibly damaging	Het
Olfr146	G	T	9: 39,019,176	R122S	probably damaging	Het
Olfr1504	C	T	19: 13,887,752	V153I	possibly damaging	Het
Olfr209	T	A	16: 59,361,808	N137Y	probably damaging	Het
Olfr324	A	G	11: 58,597,848	I151V	probably benign	Het
Olfr961	A	G	9: 39,646,872	T49A	probably benign	Het
Pak4	T	A	7: 28,568,054	I62F	possibly damaging	Het
Pcdhb12	T	A	18: 37,437,318	F506I	probably damaging	Het
Per1	A	T	11: 69,104,190	D632V	probably damaging	Het
Plec	A	G	15: 76,177,298	M2678T	probably benign	Het
Plg	A	G	17: 12,411,447		probably benign	Het
Prmt1	A	T	7: 44,977,624	S304R	probably damaging	Het
Prr27	T	C	5: 87,842,678	F50L	probably benign	Het
Prune2	T	C	19: 17,006,753	L159P	probably damaging	Het
Ptpn12	A	T	5: 20,998,483	N432K	possibly damaging	Het
Rfwd3	A	G	8: 111,293,989		probably null	Het
Rims2	A	T	15: 39,567,030	D1170V	probably damaging	Het
Sag	T	C	1: 87,834,629		probably null	Het
Sall4	C	T	2: 168,756,336	A195T	probably benign	Het
Sbf2	G	A	7: 110,367,323		probably benign	Het
Scaper	A	T	9: 55,609,874	D599E	possibly damaging	Het
Sema7a	G	A	9: 57,960,593	S484N	possibly damaging	Het
Senp1	A	G	15: 98,064,880		probably benign	Het
Senp6	A	G	9: 80,123,884	T623A	probably damaging	Het
Siae	A	G	9: 37,627,794	D95G	probably benign	Het
Slc26a2	T	C	18: 61,198,379	D660G	probably damaging	Het
Slc3a1	T	C	17: 85,028,649	F73S	possibly damaging	Het
Slfn5	A	T	11: 82,961,040	Q664L	probably damaging	Het
Spire1	T	C	18: 67,491,305	I512V	probably damaging	Het
Srpr	A	G	9: 35,213,501	T133A	probably benign	Het
Stag1	A	G	9: 100,954,247	*175W	probably null	Het
Stk32c	C	A	7: 139,120,720	V316F	probably damaging	Het
Tekt1	A	C	11: 72,345,594	N347K	possibly damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tnpo2	T	A	8: 85,050,157	C498S	probably damaging	Het
Tra2b	G	A	16: 22,247,205	R281*	probably null	Het
Ubr5	A	T	15: 37,991,344	I1985N	probably benign	Het
Ush2a	T	G	1: 188,443,181	S1159A	probably benign	Het
Vmn1r15	C	T	6: 57,258,251	P35S	probably benign	Het
Vmn1r6	A	T	6: 57,002,598	I60L	probably benign	Het
Vps8	A	G	16: 21,459,811		probably benign	Het
Xkr7	T	C	2: 153,032,352	V113A	possibly damaging	Het

Other mutations in Best3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Best3	APN	10	116988727	missense	probably damaging	1.00
IGL00158:Best3	APN	10	117004541	splice site	probably benign
IGL02493:Best3	APN	10	117024601	missense	possibly damaging	0.95
IGL02713:Best3	APN	10	117024529	missense	probably benign	0.00
IGL03178:Best3	APN	10	116988779	missense	probably damaging	1.00
IGL03355:Best3	APN	10	116993105	missense	possibly damaging	0.82
R0578:Best3	UTSW	10	117008999	missense	probably benign	0.06
R1671:Best3	UTSW	10	117024668	missense	possibly damaging	0.58
R1769:Best3	UTSW	10	117023978	missense	probably benign	0.00
R1860:Best3	UTSW	10	116993273	missense	probably damaging	1.00
R1935:Best3	UTSW	10	117024386	missense	probably benign
R2103:Best3	UTSW	10	117002594	missense	probably benign	0.01
R3942:Best3	UTSW	10	116988674	missense	possibly damaging	0.49
R4260:Best3	UTSW	10	117024226	missense	probably benign
R4332:Best3	UTSW	10	117002524	missense	probably benign	0.37
R4741:Best3	UTSW	10	117023996	missense	probably benign	0.06
R4760:Best3	UTSW	10	117024794	missense	probably benign	0.00
R4896:Best3	UTSW	10	117024555	missense	probably benign	0.00
R4912:Best3	UTSW	10	117008981	missense	probably damaging	1.00
R5023:Best3	UTSW	10	116988742	missense	probably benign	0.06
R5087:Best3	UTSW	10	117009002	missense	probably benign	0.01
R5213:Best3	UTSW	10	117024472	missense	probably benign	0.01
R5457:Best3	UTSW	10	117004511	missense	probably damaging	1.00
R5928:Best3	UTSW	10	117007627	missense	probably damaging	1.00
R5982:Best3	UTSW	10	117004417	missense	probably damaging	0.98
R6335:Best3	UTSW	10	117002651	missense	probably benign	0.32
R7068:Best3	UTSW	10	116988638	missense	probably damaging	1.00
R7469:Best3	UTSW	10	117004385	missense	probably damaging	1.00
R8139:Best3	UTSW	10	117004426	missense	probably damaging	1.00
R8306:Best3	UTSW	10	117002610	missense	probably damaging	1.00
R8715:Best3	UTSW	10	116993066	missense	probably damaging	1.00
R8847:Best3	UTSW	10	116988667	missense	possibly damaging	0.83
R9104:Best3	UTSW	10	117024775	missense	probably benign
R9506:Best3	UTSW	10	117003921	missense	probably damaging	0.99
R9579:Best3	UTSW	10	116993195	missense	probably damaging	0.96
R9635:Best3	UTSW	10	117002545	missense	probably damaging	0.99
RF014:Best3	UTSW	10	117004505	missense	probably damaging	1.00
Z1088:Best3	UTSW	10	117024170	missense	probably benign	0.00
Z1176:Best3	UTSW	10	117024622	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- TGGCATTCCGCTGGTTTACACAC -3'
(R):5'- GACACAGAGATTGTCGCCTACCTTG -3'

Sequencing Primer
(F):5'- atctccctatgtccacccc -3'
(R):5'- ACCTTGAGCCATCCTGCG -3'

Posted On

2013-06-12