Incidental Mutation 'R0531:Fam161a'
ID49173
Institutional Source Beutler Lab
Gene Symbol Fam161a
Ensembl Gene ENSMUSG00000049811
Gene Namefamily with sequence similarity 161, member A
Synonyms4930430E16Rik
MMRRC Submission 038723-MU
Accession Numbers

Genbank: NM_028672; MGI: 1921123

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23007531-23030788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23020298 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 159 (E159K)
Ref Sequence ENSEMBL: ENSMUSP00000134485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058269] [ENSMUST00000109557] [ENSMUST00000151877] [ENSMUST00000172602] [ENSMUST00000173923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058269
AA Change: E159K

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063091
Gene: ENSMUSG00000049811
AA Change: E159K

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094363
SMART Domains Protein: ENSMUSP00000091923
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
Pfam:UPF0564 1 136 3.6e-15 PFAM
low complexity region 181 202 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109557
AA Change: E159K

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105184
Gene: ENSMUSG00000049811
AA Change: E159K

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 350 8.1e-36 PFAM
low complexity region 396 417 N/A INTRINSIC
coiled coil region 437 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151877
SMART Domains Protein: ENSMUSP00000121167
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
Pfam:UPF0564 1 263 2.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172602
AA Change: E159K

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134485
Gene: ENSMUSG00000049811
AA Change: E159K

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173923
SMART Domains Protein: ENSMUSP00000133293
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208732
AA Change: E100K
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the FAM161 family. It is expressed mainly in the retina. Mouse studies suggested that this gene is involved in development of retinal progenitors during embryogenesis, and that its activity is restricted to mature photoreceptors after birth. Mutations in this gene cause autosomal recessive retinitis pigmentosa-28. Alternatively spliced transcript variants have been identified.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show early loss of visual function associated with alterations in photoreceptor ciliary structure, abnormal photoreceptor outer segment morphology, microgliosis, and progressive retinal photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Fam161a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Fam161a APN 11 23015894 unclassified probably benign
IGL01457:Fam161a APN 11 23020702 nonsense probably null
IGL01823:Fam161a APN 11 23015785 missense probably damaging 1.00
IGL02111:Fam161a APN 11 23020026 missense probably benign 0.05
3-1:Fam161a UTSW 11 23023429 critical splice acceptor site probably null
R1524:Fam161a UTSW 11 23015826 missense possibly damaging 0.80
R1550:Fam161a UTSW 11 23020470 missense possibly damaging 0.58
R1599:Fam161a UTSW 11 23021093 missense probably benign 0.43
R3744:Fam161a UTSW 11 23020410 missense probably damaging 1.00
R3962:Fam161a UTSW 11 23023507 missense possibly damaging 0.82
R4352:Fam161a UTSW 11 23020798 missense possibly damaging 0.90
R4607:Fam161a UTSW 11 23020710 missense probably benign 0.03
R4820:Fam161a UTSW 11 23020076 missense probably damaging 1.00
R5057:Fam161a UTSW 11 23020397 missense probably damaging 1.00
R5207:Fam161a UTSW 11 23020583 nonsense probably null
R5645:Fam161a UTSW 11 23015725 missense probably damaging 1.00
R5705:Fam161a UTSW 11 23028869 missense unknown
R7107:Fam161a UTSW 11 23023452 missense possibly damaging 0.84
R7203:Fam161a UTSW 11 23021664 splice site probably null
R7242:Fam161a UTSW 11 23020037 missense possibly damaging 0.81
R7286:Fam161a UTSW 11 23020001 missense possibly damaging 0.58
R7483:Fam161a UTSW 11 23021006 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATCGGAAAAGAGCTGCTCAC -3'
(R):5'- AAAAGGTCTCTCAGCTTCTTCTCGC -3'

Sequencing Primer
(F):5'- CTTGTCCACAACTACTGATGAGGG -3'
(R):5'- CTCGCAATGAACTTAAAGGGCTTC -3'
Posted On2013-06-12