Mutagenetix > Incidental Mutation

Incidental Mutation 'R0531:Ubr5'

49183

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

038723-MU

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0531 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37991344 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1985 (I1985N)

Ref Sequence

ENSEMBL: ENSMUSP00000154293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110336
AA Change: I1979N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: I1979N

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226414
AA Change: I1985N

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228292

Meta Mutation Damage Score

0.0705

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,915,146	N130D	probably benign	Het
4932438A13Rik	T	A	3: 37,036,825	I743N	probably damaging	Het
Acot6	C	A	12: 84,101,301	D110E	probably benign	Het
Agrn	T	A	4: 156,179,434	N124I	probably benign	Het
Astn1	G	T	1: 158,600,389	G710V	probably damaging	Het
Bcar3	T	C	3: 122,426,499	V15A	probably benign	Het
Best3	T	C	10: 117,004,375		probably benign	Het
Cenpa	T	C	5: 30,672,493	F39L	possibly damaging	Het
Cfap44	A	T	16: 44,401,426	M1L	probably benign	Het
Chrnd	A	G	1: 87,194,819	I107M	probably damaging	Het
Col11a2	A	G	17: 34,058,377		probably benign	Het
Dnah10	G	A	5: 124,812,723		probably null	Het
Entpd8	A	G	2: 25,084,769	Y404C	probably damaging	Het
Fam118a	T	C	15: 85,048,432	I125T	possibly damaging	Het
Fam129a	T	C	1: 151,718,084	V840A	probably benign	Het
Fam161a	G	A	11: 23,020,298	E159K	possibly damaging	Het
Fkbp5	A	T	17: 28,438,029	H71Q	probably benign	Het
Frem2	A	T	3: 53,519,954	Y2926N	probably damaging	Het
Gap43	A	T	16: 42,292,328	D23E	probably damaging	Het
Glt8d1	T	C	14: 31,006,504	F3S	probably benign	Het
Gm11555	C	T	11: 99,650,018		probably benign	Het
Gtpbp1	G	A	15: 79,720,091	G667S	probably damaging	Het
H2-T24	A	C	17: 36,015,571	S145R	probably benign	Het
Inpp5b	A	T	4: 124,795,456	N843I	probably damaging	Het
Jak3	C	T	8: 71,686,976		probably benign	Het
Krt8	T	A	15: 102,001,448	M174L	probably benign	Het
Ktn1	C	T	14: 47,663,941	T52I	probably damaging	Het
Lrp4	T	C	2: 91,475,178		probably benign	Het
Nefh	G	A	11: 4,940,240	A793V	probably damaging	Het
Notch1	A	G	2: 26,466,572	S1678P	probably benign	Het
Notch2	C	T	3: 98,102,451		probably benign	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1346	A	T	7: 6,474,235	I42F	possibly damaging	Het
Olfr146	G	T	9: 39,019,176	R122S	probably damaging	Het
Olfr1504	C	T	19: 13,887,752	V153I	possibly damaging	Het
Olfr209	T	A	16: 59,361,808	N137Y	probably damaging	Het
Olfr324	A	G	11: 58,597,848	I151V	probably benign	Het
Olfr961	A	G	9: 39,646,872	T49A	probably benign	Het
Pak4	T	A	7: 28,568,054	I62F	possibly damaging	Het
Pcdhb12	T	A	18: 37,437,318	F506I	probably damaging	Het
Per1	A	T	11: 69,104,190	D632V	probably damaging	Het
Plec	A	G	15: 76,177,298	M2678T	probably benign	Het
Plg	A	G	17: 12,411,447		probably benign	Het
Prmt1	A	T	7: 44,977,624	S304R	probably damaging	Het
Prr27	T	C	5: 87,842,678	F50L	probably benign	Het
Prune2	T	C	19: 17,006,753	L159P	probably damaging	Het
Ptpn12	A	T	5: 20,998,483	N432K	possibly damaging	Het
Rfwd3	A	G	8: 111,293,989		probably null	Het
Rims2	A	T	15: 39,567,030	D1170V	probably damaging	Het
Sag	T	C	1: 87,834,629		probably null	Het
Sall4	C	T	2: 168,756,336	A195T	probably benign	Het
Sbf2	G	A	7: 110,367,323		probably benign	Het
Scaper	A	T	9: 55,609,874	D599E	possibly damaging	Het
Sema7a	G	A	9: 57,960,593	S484N	possibly damaging	Het
Senp1	A	G	15: 98,064,880		probably benign	Het
Senp6	A	G	9: 80,123,884	T623A	probably damaging	Het
Siae	A	G	9: 37,627,794	D95G	probably benign	Het
Slc26a2	T	C	18: 61,198,379	D660G	probably damaging	Het
Slc3a1	T	C	17: 85,028,649	F73S	possibly damaging	Het
Slfn5	A	T	11: 82,961,040	Q664L	probably damaging	Het
Spire1	T	C	18: 67,491,305	I512V	probably damaging	Het
Srpr	A	G	9: 35,213,501	T133A	probably benign	Het
Stag1	A	G	9: 100,954,247	*175W	probably null	Het
Stk32c	C	A	7: 139,120,720	V316F	probably damaging	Het
Tekt1	A	C	11: 72,345,594	N347K	possibly damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tnpo2	T	A	8: 85,050,157	C498S	probably damaging	Het
Tra2b	G	A	16: 22,247,205	R281*	probably null	Het
Ush2a	T	G	1: 188,443,181	S1159A	probably benign	Het
Vmn1r15	C	T	6: 57,258,251	P35S	probably benign	Het
Vmn1r6	A	T	6: 57,002,598	I60L	probably benign	Het
Vps8	A	G	16: 21,459,811		probably benign	Het
Xkr7	T	C	2: 153,032,352	V113A	possibly damaging	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
Anchovy	UTSW	15	37979832	missense	probably null
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4467:Ubr5	UTSW	15	38004336	missense	probably damaging	1.00
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R8191:Ubr5	UTSW	15	38006507	missense
R8342:Ubr5	UTSW	15	38024837	missense
R8745:Ubr5	UTSW	15	38024795	missense
R8811:Ubr5	UTSW	15	38040879	missense
R8904:Ubr5	UTSW	15	38041909	missense
R8955:Ubr5	UTSW	15	38029581	missense
R8956:Ubr5	UTSW	15	38015123	missense	probably damaging	1.00
R9051:Ubr5	UTSW	15	38002259	missense
R9102:Ubr5	UTSW	15	38018352	missense
R9183:Ubr5	UTSW	15	37997176	missense
R9235:Ubr5	UTSW	15	38045738	missense
R9392:Ubr5	UTSW	15	37984007	missense
R9473:Ubr5	UTSW	15	38002373	missense
R9596:Ubr5	UTSW	15	37985969	missense
R9659:Ubr5	UTSW	15	37984010	missense
R9683:Ubr5	UTSW	15	37978027	missense
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- AGCTGCCCTTACAAGACTCTCTCAT -3'
(R):5'- TGTCTGATGGCGCTTGCCTAAC -3'

Sequencing Primer
(F):5'- GGAAAATTCAGAGCATTAACTCAGTC -3'
(R):5'- gcagattgtcctctggcttc -3'

Posted On

2013-06-12