Incidental Mutation 'R0531:Rims2'
ID49184
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Nameregulating synaptic membrane exocytosis 2
Synonyms2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location39198261-39684372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39567030 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1170 (D1170V)
Ref Sequence ENSEMBL: ENSMUSP00000154153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042917
AA Change: D1192V

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: D1192V

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082054
AA Change: D1150V

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: D1150V

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227243
AA Change: D1170V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect unknown
Transcript: ENSMUST00000227381
AA Change: D890V
Meta Mutation Damage Score 0.4413 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
PIT4486001:Rims2 UTSW 15 39476520 missense possibly damaging 0.67
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0367:Rims2 UTSW 15 39462615 splice site probably null
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1985:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2260:Rims2 UTSW 15 39478566 nonsense probably null
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4425:Rims2 UTSW 15 39437924 critical splice donor site probably null
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4936:Rims2 UTSW 15 39437728 missense probably damaging 1.00
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 intron probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5822:Rims2 UTSW 15 39476490 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6502:Rims2 UTSW 15 39534855 missense probably benign 0.42
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
R7058:Rims2 UTSW 15 39585648 missense probably damaging 1.00
R7167:Rims2 UTSW 15 39437077 missense probably benign
R7217:Rims2 UTSW 15 39476489 missense probably damaging 0.99
R7223:Rims2 UTSW 15 39437032 missense probably benign 0.30
R7289:Rims2 UTSW 15 39437718 missense probably benign 0.00
R7459:Rims2 UTSW 15 39517839 missense probably benign
R7663:Rims2 UTSW 15 39507026 missense probably damaging 1.00
X0034:Rims2 UTSW 15 39437534 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGACACAGATGGGCCAATGTTTT -3'
(R):5'- TCCCTAAGAGTTGGTACACAAGCACA -3'

Sequencing Primer
(F):5'- GAGTGAAAGTAGCTTATCAGCTTC -3'
(R):5'- GAGTTGGTACACAAGCACATCATAC -3'
Posted On2013-06-12