Incidental Mutation 'R0531:Krt8'
ID49189
Institutional Source Beutler Lab
Gene Symbol Krt8
Ensembl Gene ENSMUSG00000049382
Gene Namekeratin 8
SynonymsKrt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0531 (G1)
Quality Score155
Status Validated
Chromosome15
Chromosomal Location101996698-102004482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102001448 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 174 (M174L)
Ref Sequence ENSEMBL: ENSMUSP00000023952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023952]
Predicted Effect probably benign
Transcript: ENSMUST00000023952
AA Change: M174L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: M174L

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 93 9.4e-18 PFAM
Filament 96 407 7.82e-188 SMART
low complexity region 421 438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230247
Meta Mutation Damage Score 0.1040 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Krt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Krt8 APN 15 101998025 missense probably benign
IGL01643:Krt8 APN 15 101997073 missense possibly damaging 0.64
IGL01966:Krt8 APN 15 101997670 missense probably benign 0.08
IGL02587:Krt8 APN 15 101998932 missense probably benign 0.04
IGL03088:Krt8 APN 15 102000587 missense possibly damaging 0.90
R1451:Krt8 UTSW 15 101998829 missense possibly damaging 0.93
R2258:Krt8 UTSW 15 101998822 missense probably benign
R2348:Krt8 UTSW 15 101998865 missense probably benign 0.31
R2566:Krt8 UTSW 15 101998024 missense probably benign 0.03
R3796:Krt8 UTSW 15 101999442 missense probably benign 0.00
R4834:Krt8 UTSW 15 101998821 missense probably damaging 1.00
R4965:Krt8 UTSW 15 101996951 missense probably benign
R5212:Krt8 UTSW 15 101997967 missense possibly damaging 0.52
R5249:Krt8 UTSW 15 101998440 missense possibly damaging 0.69
R5419:Krt8 UTSW 15 102003902 missense probably damaging 0.98
R5778:Krt8 UTSW 15 102003939 missense probably damaging 0.99
R5997:Krt8 UTSW 15 102000594 missense possibly damaging 0.77
R6503:Krt8 UTSW 15 101997934 missense possibly damaging 0.66
R6683:Krt8 UTSW 15 101998004 missense probably benign
R6812:Krt8 UTSW 15 101997979 missense probably damaging 0.99
R6824:Krt8 UTSW 15 101998440 missense possibly damaging 0.50
R6875:Krt8 UTSW 15 101997908 missense probably benign 0.44
R7650:Krt8 UTSW 15 102004163 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACCCAACCTTATGCTCAGCCAGTG -3'
(R):5'- TCCTGGAGCAGCAGAACAAGATGC -3'

Sequencing Primer
(F):5'- caatcctcctgcctctgtc -3'
(R):5'- CTGGAGACCAAGTGGAGCC -3'
Posted On2013-06-12