Mutagenetix > Incidental Mutation

Incidental Mutation 'R0531:Prune2'

49204

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

038723-MU

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0531 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17006753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 159 (L159P)

Ref Sequence

ENSEMBL: ENSMUSP00000084977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087689
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: L159P

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224145

Meta Mutation Damage Score

0.6741

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,915,146	N130D	probably benign	Het
4932438A13Rik	T	A	3: 37,036,825	I743N	probably damaging	Het
Acot6	C	A	12: 84,101,301	D110E	probably benign	Het
Agrn	T	A	4: 156,179,434	N124I	probably benign	Het
Astn1	G	T	1: 158,600,389	G710V	probably damaging	Het
Bcar3	T	C	3: 122,426,499	V15A	probably benign	Het
Best3	T	C	10: 117,004,375		probably benign	Het
Cenpa	T	C	5: 30,672,493	F39L	possibly damaging	Het
Cfap44	A	T	16: 44,401,426	M1L	probably benign	Het
Chrnd	A	G	1: 87,194,819	I107M	probably damaging	Het
Col11a2	A	G	17: 34,058,377		probably benign	Het
Dnah10	G	A	5: 124,812,723		probably null	Het
Entpd8	A	G	2: 25,084,769	Y404C	probably damaging	Het
Fam118a	T	C	15: 85,048,432	I125T	possibly damaging	Het
Fam129a	T	C	1: 151,718,084	V840A	probably benign	Het
Fam161a	G	A	11: 23,020,298	E159K	possibly damaging	Het
Fkbp5	A	T	17: 28,438,029	H71Q	probably benign	Het
Frem2	A	T	3: 53,519,954	Y2926N	probably damaging	Het
Gap43	A	T	16: 42,292,328	D23E	probably damaging	Het
Glt8d1	T	C	14: 31,006,504	F3S	probably benign	Het
Gm11555	C	T	11: 99,650,018		probably benign	Het
Gtpbp1	G	A	15: 79,720,091	G667S	probably damaging	Het
H2-T24	A	C	17: 36,015,571	S145R	probably benign	Het
Inpp5b	A	T	4: 124,795,456	N843I	probably damaging	Het
Jak3	C	T	8: 71,686,976		probably benign	Het
Krt8	T	A	15: 102,001,448	M174L	probably benign	Het
Ktn1	C	T	14: 47,663,941	T52I	probably damaging	Het
Lrp4	T	C	2: 91,475,178		probably benign	Het
Nefh	G	A	11: 4,940,240	A793V	probably damaging	Het
Notch1	A	G	2: 26,466,572	S1678P	probably benign	Het
Notch2	C	T	3: 98,102,451		probably benign	Het
Nrxn3	T	C	12: 88,795,342	F53S	probably damaging	Het
Olfr1346	A	T	7: 6,474,235	I42F	possibly damaging	Het
Olfr146	G	T	9: 39,019,176	R122S	probably damaging	Het
Olfr1504	C	T	19: 13,887,752	V153I	possibly damaging	Het
Olfr209	T	A	16: 59,361,808	N137Y	probably damaging	Het
Olfr324	A	G	11: 58,597,848	I151V	probably benign	Het
Olfr961	A	G	9: 39,646,872	T49A	probably benign	Het
Pak4	T	A	7: 28,568,054	I62F	possibly damaging	Het
Pcdhb12	T	A	18: 37,437,318	F506I	probably damaging	Het
Per1	A	T	11: 69,104,190	D632V	probably damaging	Het
Plec	A	G	15: 76,177,298	M2678T	probably benign	Het
Plg	A	G	17: 12,411,447		probably benign	Het
Prmt1	A	T	7: 44,977,624	S304R	probably damaging	Het
Prr27	T	C	5: 87,842,678	F50L	probably benign	Het
Ptpn12	A	T	5: 20,998,483	N432K	possibly damaging	Het
Rfwd3	A	G	8: 111,293,989		probably null	Het
Rims2	A	T	15: 39,567,030	D1170V	probably damaging	Het
Sag	T	C	1: 87,834,629		probably null	Het
Sall4	C	T	2: 168,756,336	A195T	probably benign	Het
Sbf2	G	A	7: 110,367,323		probably benign	Het
Scaper	A	T	9: 55,609,874	D599E	possibly damaging	Het
Sema7a	G	A	9: 57,960,593	S484N	possibly damaging	Het
Senp1	A	G	15: 98,064,880		probably benign	Het
Senp6	A	G	9: 80,123,884	T623A	probably damaging	Het
Siae	A	G	9: 37,627,794	D95G	probably benign	Het
Slc26a2	T	C	18: 61,198,379	D660G	probably damaging	Het
Slc3a1	T	C	17: 85,028,649	F73S	possibly damaging	Het
Slfn5	A	T	11: 82,961,040	Q664L	probably damaging	Het
Spire1	T	C	18: 67,491,305	I512V	probably damaging	Het
Srpr	A	G	9: 35,213,501	T133A	probably benign	Het
Stag1	A	G	9: 100,954,247	*175W	probably null	Het
Stk32c	C	A	7: 139,120,720	V316F	probably damaging	Het
Tekt1	A	C	11: 72,345,594	N347K	possibly damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tnpo2	T	A	8: 85,050,157	C498S	probably damaging	Het
Tra2b	G	A	16: 22,247,205	R281*	probably null	Het
Ubr5	A	T	15: 37,991,344	I1985N	probably benign	Het
Ush2a	T	G	1: 188,443,181	S1159A	probably benign	Het
Vmn1r15	C	T	6: 57,258,251	P35S	probably benign	Het
Vmn1r6	A	T	6: 57,002,598	I60L	probably benign	Het
Vps8	A	G	16: 21,459,811		probably benign	Het
Xkr7	T	C	2: 153,032,352	V113A	possibly damaging	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGCCGTTTAGCGGAAATCATC -3'
(R):5'- AGGAACTGGCTCTCGCTCTCTAAC -3'

Sequencing Primer
(F):5'- CGTTTAGCGGAAATCATCAGGAC -3'
(R):5'- CTTGTCTAGTGAAACAGTGCAG -3'

Posted On

2013-06-12