Incidental Mutation 'R0533:Tbc1d8'
ID 49296
Institutional Source Beutler Lab
Gene Symbol Tbc1d8
Ensembl Gene ENSMUSG00000003134
Gene Name TBC1 domain family, member 8
Synonyms GRAM domain, AD3, HBLP1, BUB2-like protein 1
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 39371492-39478755 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 39372774 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 994 (Q994K)
Ref Sequence ENSEMBL: ENSMUSP00000049967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000086535] [ENSMUST00000178079] [ENSMUST00000179954] [ENSMUST00000192531] [ENSMUST00000193823] [ENSMUST00000194746] [ENSMUST00000195123]
AlphaFold Q9Z1A9
Predicted Effect possibly damaging
Transcript: ENSMUST00000054462
AA Change: Q994K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134
AA Change: Q994K

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 3.6e-20 SMART
GRAM 285 353 2.77e-21 SMART
TBC 501 714 4.51e-54 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 991 N/A INTRINSIC
low complexity region 1030 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086535
SMART Domains Protein: ENSMUSP00000083722
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178079
SMART Domains Protein: ENSMUSP00000136354
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179954
SMART Domains Protein: ENSMUSP00000137631
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191855
Predicted Effect probably benign
Transcript: ENSMUST00000192099
Predicted Effect probably benign
Transcript: ENSMUST00000192531
SMART Domains Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 80 98 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193823
SMART Domains Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 1.2e-22 SMART
GRAM 285 353 9.6e-24 SMART
TBC 501 714 2.2e-56 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194746
SMART Domains Protein: ENSMUSP00000141808
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-40 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195123
SMART Domains Protein: ENSMUSP00000142039
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 83 7.9e-29 PFAM
Meta Mutation Damage Score 0.1255 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Tbc1d8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tbc1d8 APN 1 39394129 missense probably damaging 0.96
IGL01501:Tbc1d8 APN 1 39389335 missense probably damaging 1.00
IGL01548:Tbc1d8 APN 1 39381304 missense probably damaging 0.96
IGL01884:Tbc1d8 APN 1 39376445 missense probably damaging 1.00
IGL01919:Tbc1d8 APN 1 39392253 missense probably damaging 1.00
IGL02123:Tbc1d8 APN 1 39376907 missense possibly damaging 0.54
IGL02123:Tbc1d8 APN 1 39380236 missense probably damaging 0.98
IGL02135:Tbc1d8 APN 1 39402810 missense probably damaging 1.00
IGL02317:Tbc1d8 APN 1 39376904 missense probably benign 0.00
IGL02325:Tbc1d8 APN 1 39394240 missense probably damaging 0.99
IGL02607:Tbc1d8 APN 1 39379511 missense probably benign 0.05
R0604:Tbc1d8 UTSW 1 39405326 missense probably damaging 1.00
R0612:Tbc1d8 UTSW 1 39372515 missense possibly damaging 0.92
R0639:Tbc1d8 UTSW 1 39391209 missense probably benign 0.00
R0976:Tbc1d8 UTSW 1 39406801 missense probably damaging 1.00
R1051:Tbc1d8 UTSW 1 39381453 nonsense probably null
R1605:Tbc1d8 UTSW 1 39391125 missense probably benign 0.38
R1622:Tbc1d8 UTSW 1 39380236 missense probably benign 0.00
R1710:Tbc1d8 UTSW 1 39406837 missense possibly damaging 0.89
R2419:Tbc1d8 UTSW 1 39376902 missense probably damaging 1.00
R2437:Tbc1d8 UTSW 1 39405287 splice site probably null
R2862:Tbc1d8 UTSW 1 39402696 nonsense probably null
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2870:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2873:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R2874:Tbc1d8 UTSW 1 39405317 missense probably damaging 1.00
R3759:Tbc1d8 UTSW 1 39376465 missense probably damaging 1.00
R4127:Tbc1d8 UTSW 1 39372431 missense probably benign 0.05
R4154:Tbc1d8 UTSW 1 39386135 missense probably damaging 0.99
R4613:Tbc1d8 UTSW 1 39372708 missense probably damaging 0.98
R4737:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4738:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4739:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R4740:Tbc1d8 UTSW 1 39402878 missense possibly damaging 0.63
R5189:Tbc1d8 UTSW 1 39385132 missense probably benign 0.00
R5271:Tbc1d8 UTSW 1 39373767 missense probably damaging 0.97
R5308:Tbc1d8 UTSW 1 39389409 missense probably damaging 1.00
R5393:Tbc1d8 UTSW 1 39426088 missense probably damaging 0.99
R5529:Tbc1d8 UTSW 1 39372755 missense probably benign 0.42
R5897:Tbc1d8 UTSW 1 39392109 missense possibly damaging 0.95
R6160:Tbc1d8 UTSW 1 39372403 missense probably damaging 0.98
R6408:Tbc1d8 UTSW 1 39402899 missense probably damaging 0.99
R6409:Tbc1d8 UTSW 1 39372588 missense probably benign 0.00
R6554:Tbc1d8 UTSW 1 39406822 missense probably damaging 1.00
R6841:Tbc1d8 UTSW 1 39389374 missense possibly damaging 0.68
R7282:Tbc1d8 UTSW 1 39372533 missense probably benign 0.00
R7294:Tbc1d8 UTSW 1 39406762 missense probably damaging 1.00
R7384:Tbc1d8 UTSW 1 39394098 missense probably benign 0.00
R7718:Tbc1d8 UTSW 1 39376980 missense probably benign 0.00
R7881:Tbc1d8 UTSW 1 39386023 missense probably damaging 0.98
R7918:Tbc1d8 UTSW 1 39402728 missense probably damaging 1.00
R7972:Tbc1d8 UTSW 1 39392169 missense probably damaging 1.00
R8269:Tbc1d8 UTSW 1 39426088 missense probably benign 0.00
R8352:Tbc1d8 UTSW 1 39405357 missense probably damaging 1.00
R8425:Tbc1d8 UTSW 1 39381409 missense probably damaging 1.00
R8452:Tbc1d8 UTSW 1 39405357 missense probably damaging 1.00
R9159:Tbc1d8 UTSW 1 39405393 missense
R9712:Tbc1d8 UTSW 1 39385232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCTCAGTGAGAAGGGATGC -3'
(R):5'- TGCTTGTGGGACACAACTATCACC -3'

Sequencing Primer
(F):5'- GCAAAAACTGAGTCCTGTTCG -3'
(R):5'- CTATCACCCAGTGTTTACTGGAGAG -3'
Posted On 2013-06-12