Incidental Mutation 'R0533:Adcy10'
ID 49299
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms sAC, Sacy, soluble adenylyl cyclase
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 165485183-165576774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 165564023 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1283 (N1283S)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: N1283S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: N1283S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: N1283S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: N1283S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: N1283S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: N1283S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
Bugged UTSW 1 165564237 missense probably damaging 0.99
debye UTSW 1 165551361 critical splice donor site probably null
malaysian UTSW 1 165513127 missense probably benign 0.38
singaporean UTSW 1 165518312 missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 splice site probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165546549 missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165503288 missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165510337 missense probably benign 0.34
R8812:Adcy10 UTSW 1 165551298 missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165518345 missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165575649 missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165543110 missense probably benign 0.00
R9712:Adcy10 UTSW 1 165513112 missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCAGCCACCTAGTTTGATTTCTGTACC -3'
(R):5'- GATTCCGAAGAAGTGACCACATCCTG -3'

Sequencing Primer
(F):5'- GCTCCGTGTTTAACAAACAAAGG -3'
(R):5'- GCCTGGGGAGAAAGCAATC -3'
Posted On 2013-06-12