Incidental Mutation 'R0533:Clic3'
ID 49301
Institutional Source Beutler Lab
Gene Symbol Clic3
Ensembl Gene ENSMUSG00000015093
Gene Name chloride intracellular channel 3
Synonyms 2300003G24Rik
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25346855-25348789 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25348150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 99 (Y99C)
Ref Sequence ENSEMBL: ENSMUSP00000109904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102918] [ENSMUST00000114261] [ENSMUST00000114265] [ENSMUST00000151239]
AlphaFold Q9D7P7
Predicted Effect probably damaging
Transcript: ENSMUST00000102918
AA Change: Y97C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099982
Gene: ENSMUSG00000015093
AA Change: Y97C

DomainStartEndE-ValueType
Pfam:GST_N_3 17 89 9.8e-11 PFAM
Pfam:GST_N_2 20 84 1.6e-8 PFAM
Pfam:GST_C_2 77 207 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114261
SMART Domains Protein: ENSMUSP00000109899
Gene: ENSMUSG00000047617

DomainStartEndE-ValueType
Pfam:PAXX 10 205 5.7e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114265
AA Change: Y99C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109904
Gene: ENSMUSG00000015093
AA Change: Y99C

DomainStartEndE-ValueType
Pfam:GST_N_3 19 91 2e-11 PFAM
Pfam:GST_N_2 22 86 3.6e-9 PFAM
Pfam:GST_C_2 80 209 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141613
Predicted Effect probably benign
Transcript: ENSMUST00000151239
SMART Domains Protein: ENSMUSP00000120533
Gene: ENSMUSG00000047617

DomainStartEndE-ValueType
Pfam:DUF4610 8 156 2.2e-64 PFAM
Meta Mutation Damage Score 0.3378 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Clic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
knife UTSW 2 25,347,779 (GRCm39) missense possibly damaging 0.94
R0491:Clic3 UTSW 2 25,347,797 (GRCm39) unclassified probably benign
R4798:Clic3 UTSW 2 25,348,194 (GRCm39) missense probably damaging 1.00
R4940:Clic3 UTSW 2 25,347,929 (GRCm39) missense probably benign 0.00
R5579:Clic3 UTSW 2 25,348,319 (GRCm39) missense probably damaging 0.99
R5713:Clic3 UTSW 2 25,348,179 (GRCm39) missense probably damaging 1.00
R6669:Clic3 UTSW 2 25,347,779 (GRCm39) missense possibly damaging 0.94
R7169:Clic3 UTSW 2 25,348,731 (GRCm39) missense probably benign 0.02
R8033:Clic3 UTSW 2 25,348,617 (GRCm39) missense probably benign 0.00
R9131:Clic3 UTSW 2 25,348,325 (GRCm39) missense probably benign 0.00
R9457:Clic3 UTSW 2 25,347,730 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTGTACGATGGGGATGTCAAG -3'
(R):5'- AAGATGTGGCTCCTGTGCCAGTTC -3'

Sequencing Primer
(F):5'- GATGTCAAGACAGACACACTGC -3'
(R):5'- TGCCAGTTCGTGGTCCAG -3'
Posted On 2013-06-12