Incidental Mutation 'R0533:Clic3'
ID49301
Institutional Source Beutler Lab
Gene Symbol Clic3
Ensembl Gene ENSMUSG00000015093
Gene Namechloride intracellular channel 3
Synonyms
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0533 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25456838-25458776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25458138 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 99 (Y99C)
Ref Sequence ENSEMBL: ENSMUSP00000109904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102918] [ENSMUST00000114261] [ENSMUST00000114265] [ENSMUST00000151239]
Predicted Effect probably damaging
Transcript: ENSMUST00000102918
AA Change: Y97C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099982
Gene: ENSMUSG00000015093
AA Change: Y97C

DomainStartEndE-ValueType
Pfam:GST_N_3 17 89 9.8e-11 PFAM
Pfam:GST_N_2 20 84 1.6e-8 PFAM
Pfam:GST_C_2 77 207 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114261
SMART Domains Protein: ENSMUSP00000109899
Gene: ENSMUSG00000047617

DomainStartEndE-ValueType
Pfam:PAXX 10 205 5.7e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114265
AA Change: Y99C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109904
Gene: ENSMUSG00000015093
AA Change: Y99C

DomainStartEndE-ValueType
Pfam:GST_N_3 19 91 2e-11 PFAM
Pfam:GST_N_2 22 86 3.6e-9 PFAM
Pfam:GST_C_2 80 209 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143862
Predicted Effect probably benign
Transcript: ENSMUST00000151239
SMART Domains Protein: ENSMUSP00000120533
Gene: ENSMUSG00000047617

DomainStartEndE-ValueType
Pfam:DUF4610 8 156 2.2e-64 PFAM
Meta Mutation Damage Score 0.3378 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Clic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
knife UTSW 2 25457767 missense possibly damaging 0.94
R0491:Clic3 UTSW 2 25457785 unclassified probably benign
R4798:Clic3 UTSW 2 25458182 missense probably damaging 1.00
R4940:Clic3 UTSW 2 25457917 missense probably benign 0.00
R5579:Clic3 UTSW 2 25458307 missense probably damaging 0.99
R5713:Clic3 UTSW 2 25458167 missense probably damaging 1.00
R6669:Clic3 UTSW 2 25457767 missense possibly damaging 0.94
R7169:Clic3 UTSW 2 25458719 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGCTGTACGATGGGGATGTCAAG -3'
(R):5'- AAGATGTGGCTCCTGTGCCAGTTC -3'

Sequencing Primer
(F):5'- GATGTCAAGACAGACACACTGC -3'
(R):5'- TGCCAGTTCGTGGTCCAG -3'
Posted On2013-06-12