Incidental Mutation 'R0533:Ago4'
ID49307
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Nameargonaute RISC catalytic subunit 4
Synonymsargonaute 4, Eif2c4, 5730550L01Rik
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R0533 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126489541-126533472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126516860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 246 (V246A)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
Predicted Effect probably benign
Transcript: ENSMUST00000084289
AA Change: V246A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: V246A

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122951
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126517133 missense probably benign 0.01
IGL00965:Ago4 APN 4 126493314 missense probably benign 0.01
IGL01306:Ago4 APN 4 126515884 splice site probably null
IGL01943:Ago4 APN 4 126517195 missense probably damaging 1.00
IGL02079:Ago4 APN 4 126517084 missense probably damaging 0.99
IGL02117:Ago4 APN 4 126516852 missense probably benign 0.00
IGL02229:Ago4 APN 4 126511532 missense probably benign 0.34
IGL02503:Ago4 APN 4 126496805 nonsense probably null
IGL02504:Ago4 APN 4 126517439 missense probably benign 0.00
IGL02975:Ago4 APN 4 126512519 critical splice donor site probably null
IGL02837:Ago4 UTSW 4 126497300 missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126517183 missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126516932 missense probably benign 0.24
R0480:Ago4 UTSW 4 126526077 missense probably benign 0.00
R1014:Ago4 UTSW 4 126506785 missense probably damaging 1.00
R1350:Ago4 UTSW 4 126507132 missense probably benign 0.04
R1547:Ago4 UTSW 4 126511413 missense probably benign 0.01
R1894:Ago4 UTSW 4 126512600 missense probably benign 0.11
R1900:Ago4 UTSW 4 126516936 missense probably benign 0.00
R2510:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R2511:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R4063:Ago4 UTSW 4 126515862 intron probably benign
R4064:Ago4 UTSW 4 126515862 intron probably benign
R4120:Ago4 UTSW 4 126496807 missense probably damaging 1.00
R4916:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4917:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4918:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4941:Ago4 UTSW 4 126526054 missense probably benign 0.00
R5169:Ago4 UTSW 4 126511727 missense probably benign 0.06
R5262:Ago4 UTSW 4 126496764 missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126517556 missense probably benign
R5757:Ago4 UTSW 4 126526084 missense probably damaging 1.00
R6244:Ago4 UTSW 4 126511487 missense possibly damaging 0.67
R6256:Ago4 UTSW 4 126520226 missense probably damaging 1.00
R6389:Ago4 UTSW 4 126507244 missense probably damaging 1.00
R6545:Ago4 UTSW 4 126512018 missense probably benign 0.10
R7378:Ago4 UTSW 4 126511464 missense probably benign
R7804:Ago4 UTSW 4 126512630 missense probably benign 0.02
X0062:Ago4 UTSW 4 126515941 missense probably benign 0.00
X0064:Ago4 UTSW 4 126517482 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATCCCAATTCCCACTGCTAGGACG -3'
(R):5'- CTTTCATCAGTCTGTGAGACCTGCC -3'

Sequencing Primer
(F):5'- CACTGCTAGGACGACGTAGG -3'
(R):5'- GGGTTGGAACTCCATCTGC -3'
Posted On2013-06-12