Incidental Mutation 'R0533:Ago4'
ID 49307
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Name argonaute RISC catalytic subunit 4
Synonyms Eif2c4, 5730550L01Rik, argonaute 4
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126383334-126427265 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126410653 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 246 (V246A)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
AlphaFold Q8CJF8
Predicted Effect probably benign
Transcript: ENSMUST00000084289
AA Change: V246A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: V246A

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122951
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126,410,926 (GRCm39) missense probably benign 0.01
IGL00965:Ago4 APN 4 126,387,107 (GRCm39) missense probably benign 0.01
IGL01306:Ago4 APN 4 126,409,677 (GRCm39) splice site probably null
IGL01943:Ago4 APN 4 126,410,988 (GRCm39) missense probably damaging 1.00
IGL02079:Ago4 APN 4 126,410,877 (GRCm39) missense probably damaging 0.99
IGL02117:Ago4 APN 4 126,410,645 (GRCm39) missense probably benign 0.00
IGL02229:Ago4 APN 4 126,405,325 (GRCm39) missense probably benign 0.34
IGL02503:Ago4 APN 4 126,390,598 (GRCm39) nonsense probably null
IGL02504:Ago4 APN 4 126,411,232 (GRCm39) missense probably benign 0.00
IGL02975:Ago4 APN 4 126,406,312 (GRCm39) critical splice donor site probably null
BB010:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
BB020:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
IGL02837:Ago4 UTSW 4 126,391,093 (GRCm39) missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126,410,976 (GRCm39) missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126,410,725 (GRCm39) missense probably benign 0.24
R0480:Ago4 UTSW 4 126,419,870 (GRCm39) missense probably benign 0.00
R1014:Ago4 UTSW 4 126,400,578 (GRCm39) missense probably damaging 1.00
R1350:Ago4 UTSW 4 126,400,925 (GRCm39) missense probably benign 0.04
R1547:Ago4 UTSW 4 126,405,206 (GRCm39) missense probably benign 0.01
R1894:Ago4 UTSW 4 126,406,393 (GRCm39) missense probably benign 0.11
R1900:Ago4 UTSW 4 126,410,729 (GRCm39) missense probably benign 0.00
R2510:Ago4 UTSW 4 126,410,864 (GRCm39) missense probably damaging 1.00
R2511:Ago4 UTSW 4 126,410,864 (GRCm39) missense probably damaging 1.00
R4063:Ago4 UTSW 4 126,409,655 (GRCm39) intron probably benign
R4064:Ago4 UTSW 4 126,409,655 (GRCm39) intron probably benign
R4120:Ago4 UTSW 4 126,390,600 (GRCm39) missense probably damaging 1.00
R4916:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4917:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4918:Ago4 UTSW 4 126,400,635 (GRCm39) missense probably damaging 1.00
R4941:Ago4 UTSW 4 126,419,847 (GRCm39) missense probably benign 0.00
R5169:Ago4 UTSW 4 126,405,520 (GRCm39) missense probably benign 0.06
R5262:Ago4 UTSW 4 126,390,557 (GRCm39) missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126,411,349 (GRCm39) missense probably benign
R5757:Ago4 UTSW 4 126,419,877 (GRCm39) missense probably damaging 1.00
R6244:Ago4 UTSW 4 126,405,280 (GRCm39) missense possibly damaging 0.67
R6256:Ago4 UTSW 4 126,414,019 (GRCm39) missense probably damaging 1.00
R6389:Ago4 UTSW 4 126,401,037 (GRCm39) missense probably damaging 1.00
R6545:Ago4 UTSW 4 126,405,811 (GRCm39) missense probably benign 0.10
R7378:Ago4 UTSW 4 126,405,257 (GRCm39) missense probably benign
R7804:Ago4 UTSW 4 126,406,423 (GRCm39) missense probably benign 0.02
R7890:Ago4 UTSW 4 126,419,869 (GRCm39) missense probably benign 0.00
R7933:Ago4 UTSW 4 126,400,811 (GRCm39) missense probably benign 0.22
R8824:Ago4 UTSW 4 126,400,977 (GRCm39) missense probably benign 0.04
R8852:Ago4 UTSW 4 126,387,043 (GRCm39) missense probably benign 0.03
R8860:Ago4 UTSW 4 126,387,043 (GRCm39) missense probably benign 0.03
R9023:Ago4 UTSW 4 126,400,596 (GRCm39) missense probably damaging 1.00
R9127:Ago4 UTSW 4 126,400,904 (GRCm39) missense probably damaging 1.00
R9138:Ago4 UTSW 4 126,414,073 (GRCm39) nonsense probably null
R9447:Ago4 UTSW 4 126,402,151 (GRCm39) missense probably benign 0.13
X0062:Ago4 UTSW 4 126,409,734 (GRCm39) missense probably benign 0.00
X0064:Ago4 UTSW 4 126,411,275 (GRCm39) missense possibly damaging 0.87
Z1176:Ago4 UTSW 4 126,413,983 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCCAATTCCCACTGCTAGGACG -3'
(R):5'- CTTTCATCAGTCTGTGAGACCTGCC -3'

Sequencing Primer
(F):5'- CACTGCTAGGACGACGTAGG -3'
(R):5'- GGGTTGGAACTCCATCTGC -3'
Posted On 2013-06-12