Incidental Mutation 'R0533:Gm13089'
ID 49308
Institutional Source Beutler Lab
Gene Symbol Gm13089
Ensembl Gene ENSMUSG00000070617
Gene Name predicted gene 13089
Synonyms
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 143696500-143702711 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 143698020 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 284 (C284*)
Ref Sequence ENSEMBL: ENSMUSP00000073224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073532]
AlphaFold A2AGW7
Predicted Effect probably null
Transcript: ENSMUST00000073532
AA Change: C284*
SMART Domains Protein: ENSMUSP00000073224
Gene: ENSMUSG00000070617
AA Change: C284*

DomainStartEndE-ValueType
low complexity region 204 216 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Gm13089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Gm13089 APN 4 143696840 utr 3 prime probably benign
IGL02087:Gm13089 APN 4 143697074 missense probably damaging 0.96
IGL02296:Gm13089 APN 4 143698481 nonsense probably null
IGL02902:Gm13089 APN 4 143698343 missense probably damaging 1.00
IGL02903:Gm13089 APN 4 143699166 missense probably benign 0.04
IGL02962:Gm13089 APN 4 143697340 missense probably benign 0.28
IGL03351:Gm13089 APN 4 143697088 missense possibly damaging 0.80
R0122:Gm13089 UTSW 4 143698404 missense probably benign 0.44
R0609:Gm13089 UTSW 4 143698503 missense probably benign 0.00
R0743:Gm13089 UTSW 4 143698564 missense probably damaging 0.97
R0744:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R0833:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R1052:Gm13089 UTSW 4 143696907 missense possibly damaging 0.81
R1690:Gm13089 UTSW 4 143698123 missense probably benign 0.03
R1764:Gm13089 UTSW 4 143698270 missense probably benign 0.14
R1896:Gm13089 UTSW 4 143698144 missense probably benign 0.11
R2084:Gm13089 UTSW 4 143699350 missense probably damaging 1.00
R2178:Gm13089 UTSW 4 143698042 missense possibly damaging 0.95
R2888:Gm13089 UTSW 4 143696890 missense probably benign 0.00
R3759:Gm13089 UTSW 4 143697151 missense probably damaging 1.00
R4193:Gm13089 UTSW 4 143698333 missense probably damaging 1.00
R4380:Gm13089 UTSW 4 143698286 missense probably benign 0.21
R4385:Gm13089 UTSW 4 143698014 critical splice donor site probably null
R4513:Gm13089 UTSW 4 143698148 missense probably benign 0.00
R4647:Gm13089 UTSW 4 143699344 missense probably benign 0.00
R4920:Gm13089 UTSW 4 143699283 missense probably benign 0.05
R4994:Gm13089 UTSW 4 143698369 missense possibly damaging 0.94
R5197:Gm13089 UTSW 4 143698062 missense possibly damaging 0.86
R6005:Gm13089 UTSW 4 143698432 missense probably benign 0.00
R6073:Gm13089 UTSW 4 143698268 missense probably damaging 0.99
R6197:Gm13089 UTSW 4 143697316 missense possibly damaging 0.90
R6264:Gm13089 UTSW 4 143699152 missense possibly damaging 0.50
R6821:Gm13089 UTSW 4 143699304 nonsense probably null
R6923:Gm13089 UTSW 4 143699106 missense probably benign 0.06
R7034:Gm13089 UTSW 4 143697328 missense probably damaging 1.00
R7140:Gm13089 UTSW 4 143698432 missense probably benign 0.01
R7298:Gm13089 UTSW 4 143698505 missense probably benign 0.23
R7529:Gm13089 UTSW 4 143702674
R7766:Gm13089 UTSW 4 143699239 missense probably damaging 0.98
R7774:Gm13089 UTSW 4 143697106 missense possibly damaging 0.89
R7816:Gm13089 UTSW 4 143698194 missense probably benign 0.00
R8137:Gm13089 UTSW 4 143699265 missense probably damaging 1.00
R8937:Gm13089 UTSW 4 143696992 missense probably damaging 1.00
R8982:Gm13089 UTSW 4 143698316 missense probably benign 0.01
R9016:Gm13089 UTSW 4 143697329 missense possibly damaging 0.76
R9100:Gm13089 UTSW 4 143699157 missense probably benign 0.04
R9200:Gm13089 UTSW 4 143697286 missense possibly damaging 0.90
R9257:Gm13089 UTSW 4 143699115 missense probably damaging 1.00
R9471:Gm13089 UTSW 4 143697179 missense probably damaging 1.00
R9517:Gm13089 UTSW 4 143698360 missense possibly damaging 0.95
Z1088:Gm13089 UTSW 4 143698080 missense probably benign
Z1176:Gm13089 UTSW 4 143696945 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGAGCCCATCTTCCCTGATATGC -3'
(R):5'- GGGCAGCCTTGATGAATGTGCTAC -3'

Sequencing Primer
(F):5'- ATCTTCCCTGATATGCTATGTCTC -3'
(R):5'- GATTCAGGGCTCAATCAACG -3'
Posted On 2013-06-12