Incidental Mutation 'R0533:Pramel16'
ID 49309
Institutional Source Beutler Lab
Gene Symbol Pramel16
Ensembl Gene ENSMUSG00000078511
Gene Name PRAME like 16
Synonyms Pramef25, Gm13109
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R0533 (G1)
Quality Score 155
Status Validated
Chromosome 4
Chromosomal Location 143675150-143677586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 143677290 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 96 (D96E)
Ref Sequence ENSEMBL: ENSMUSP00000101392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105766]
AlphaFold A2ASI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000105766
AA Change: D96E

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101392
Gene: ENSMUSG00000078511
AA Change: D96E

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 427 2e-10 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Pramel16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Pramel16 APN 4 143,676,784 (GRCm39) splice site probably benign
IGL01562:Pramel16 APN 4 143,677,435 (GRCm39) missense probably damaging 1.00
IGL02422:Pramel16 APN 4 143,676,453 (GRCm39) missense probably benign 0.25
IGL02632:Pramel16 APN 4 143,676,507 (GRCm39) missense possibly damaging 0.84
IGL02745:Pramel16 APN 4 143,677,294 (GRCm39) missense probably damaging 1.00
IGL02808:Pramel16 APN 4 143,677,585 (GRCm39) utr 5 prime probably benign
IGL02883:Pramel16 APN 4 143,676,418 (GRCm39) missense possibly damaging 0.64
IGL02961:Pramel16 APN 4 143,675,717 (GRCm39) missense probably damaging 1.00
IGL03092:Pramel16 APN 4 143,676,767 (GRCm39) missense probably damaging 0.97
FR4340:Pramel16 UTSW 4 143,676,312 (GRCm39) missense probably damaging 0.99
FR4342:Pramel16 UTSW 4 143,676,327 (GRCm39) frame shift probably null
FR4342:Pramel16 UTSW 4 143,676,312 (GRCm39) missense probably damaging 0.99
R0606:Pramel16 UTSW 4 143,676,453 (GRCm39) missense probably benign 0.25
R1624:Pramel16 UTSW 4 143,676,400 (GRCm39) missense possibly damaging 0.47
R1898:Pramel16 UTSW 4 143,677,298 (GRCm39) missense probably damaging 1.00
R2029:Pramel16 UTSW 4 143,676,453 (GRCm39) missense probably benign 0.25
R2867:Pramel16 UTSW 4 143,675,456 (GRCm39) missense probably benign 0.00
R2867:Pramel16 UTSW 4 143,675,456 (GRCm39) missense probably benign 0.00
R2894:Pramel16 UTSW 4 143,675,692 (GRCm39) missense probably damaging 1.00
R4111:Pramel16 UTSW 4 143,676,475 (GRCm39) missense possibly damaging 0.93
R4298:Pramel16 UTSW 4 143,675,713 (GRCm39) nonsense probably null
R4360:Pramel16 UTSW 4 143,677,433 (GRCm39) missense possibly damaging 0.81
R4361:Pramel16 UTSW 4 143,677,433 (GRCm39) missense possibly damaging 0.81
R5137:Pramel16 UTSW 4 143,675,690 (GRCm39) missense probably benign 0.08
R5195:Pramel16 UTSW 4 143,677,450 (GRCm39) missense probably damaging 0.99
R5312:Pramel16 UTSW 4 143,675,665 (GRCm39) missense possibly damaging 0.96
R5548:Pramel16 UTSW 4 143,676,550 (GRCm39) missense probably benign 0.24
R5591:Pramel16 UTSW 4 143,675,377 (GRCm39) missense probably damaging 1.00
R5644:Pramel16 UTSW 4 143,675,374 (GRCm39) missense probably benign 0.01
R6018:Pramel16 UTSW 4 143,677,469 (GRCm39) missense possibly damaging 0.61
R6177:Pramel16 UTSW 4 143,675,576 (GRCm39) missense possibly damaging 0.51
R6335:Pramel16 UTSW 4 143,675,602 (GRCm39) missense probably benign 0.02
R6376:Pramel16 UTSW 4 143,677,267 (GRCm39) missense probably benign 0.03
R6572:Pramel16 UTSW 4 143,676,262 (GRCm39) missense probably benign 0.01
R6845:Pramel16 UTSW 4 143,676,394 (GRCm39) missense probably benign
R6939:Pramel16 UTSW 4 143,675,366 (GRCm39) missense probably benign 0.09
R7081:Pramel16 UTSW 4 143,675,848 (GRCm39) missense probably damaging 1.00
R7505:Pramel16 UTSW 4 143,676,273 (GRCm39) missense possibly damaging 0.94
R7711:Pramel16 UTSW 4 143,675,822 (GRCm39) missense probably benign 0.22
R8284:Pramel16 UTSW 4 143,676,695 (GRCm39) missense possibly damaging 0.95
R8297:Pramel16 UTSW 4 143,675,690 (GRCm39) missense probably benign 0.08
R8299:Pramel16 UTSW 4 143,677,327 (GRCm39) missense probably benign 0.24
R8700:Pramel16 UTSW 4 143,675,701 (GRCm39) missense possibly damaging 0.51
R9179:Pramel16 UTSW 4 143,676,294 (GRCm39) missense probably benign 0.01
R9199:Pramel16 UTSW 4 143,675,656 (GRCm39) missense probably damaging 1.00
R9214:Pramel16 UTSW 4 143,675,750 (GRCm39) missense probably benign 0.00
R9411:Pramel16 UTSW 4 143,676,215 (GRCm39) missense probably damaging 1.00
RF011:Pramel16 UTSW 4 143,675,478 (GRCm39) missense probably damaging 0.96
RF013:Pramel16 UTSW 4 143,675,478 (GRCm39) missense probably damaging 0.96
RF021:Pramel16 UTSW 4 143,675,478 (GRCm39) missense probably damaging 0.96
Z1176:Pramel16 UTSW 4 143,676,693 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCACATTTCTCAGGTCCAGCAC -3'
(R):5'- TTGTTCCCACCACTCTTCAAGGCAG -3'

Sequencing Primer
(F):5'- AGTGCTGGGTCTCCACATAG -3'
(R):5'- TTCAAGGCAGCCTTCACTGG -3'
Posted On 2013-06-12