Incidental Mutation 'R0533:Wrap73'
ID 49311
Institutional Source Beutler Lab
Gene Symbol Wrap73
Ensembl Gene ENSMUSG00000029029
Gene Name WD repeat containing, antisense to Trp73
Synonyms DD57, 2610044M17Rik, Wdr8, 5330425N03Rik
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.688) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 154226811-154241278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 154240611 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 368 (V368M)
Ref Sequence ENSEMBL: ENSMUSP00000030895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030895] [ENSMUST00000030896] [ENSMUST00000105639]
AlphaFold Q9JM98
Predicted Effect possibly damaging
Transcript: ENSMUST00000030895
AA Change: V368M

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030895
Gene: ENSMUSG00000029029
AA Change: V368M

DomainStartEndE-ValueType
Blast:WD40 38 77 4e-18 BLAST
Blast:WD40 81 120 6e-16 BLAST
Blast:WD40 125 163 9e-6 BLAST
WD40 167 208 2.28e2 SMART
WD40 215 251 1.58e-2 SMART
WD40 319 360 2.29e1 SMART
WD40 363 401 4.18e-2 SMART
Blast:WD40 402 443 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030896
SMART Domains Protein: ENSMUSP00000030896
Gene: ENSMUSG00000029030

DomainStartEndE-ValueType
Pfam:hSac2 56 163 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105639
SMART Domains Protein: ENSMUSP00000101264
Gene: ENSMUSG00000029030

DomainStartEndE-ValueType
Pfam:hSac2 53 106 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136374
Predicted Effect probably benign
Transcript: ENSMUST00000146734
SMART Domains Protein: ENSMUSP00000118548
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
WD40 28 64 1.58e-2 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Studies of the related mouse protein suggest that the encoded protein may play a role in the process of ossification. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Wrap73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Wrap73 APN 4 154,237,096 (GRCm39) missense probably damaging 0.99
IGL01562:Wrap73 APN 4 154,229,794 (GRCm39) missense possibly damaging 0.63
IGL01863:Wrap73 APN 4 154,229,790 (GRCm39) missense probably benign 0.02
IGL02342:Wrap73 APN 4 154,233,237 (GRCm39) missense probably benign 0.36
IGL03012:Wrap73 APN 4 154,229,691 (GRCm39) splice site probably benign
IGL03303:Wrap73 APN 4 154,231,000 (GRCm39) missense probably damaging 0.98
R0128:Wrap73 UTSW 4 154,226,957 (GRCm39) missense possibly damaging 0.81
R0455:Wrap73 UTSW 4 154,233,200 (GRCm39) missense possibly damaging 0.63
R0524:Wrap73 UTSW 4 154,229,764 (GRCm39) missense probably damaging 1.00
R0528:Wrap73 UTSW 4 154,229,776 (GRCm39) missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154,236,106 (GRCm39) missense probably damaging 1.00
R0633:Wrap73 UTSW 4 154,226,948 (GRCm39) missense probably damaging 0.98
R1118:Wrap73 UTSW 4 154,236,884 (GRCm39) splice site probably null
R1669:Wrap73 UTSW 4 154,240,588 (GRCm39) missense probably damaging 0.99
R1725:Wrap73 UTSW 4 154,233,209 (GRCm39) missense possibly damaging 0.73
R2070:Wrap73 UTSW 4 154,233,200 (GRCm39) missense possibly damaging 0.63
R4530:Wrap73 UTSW 4 154,241,164 (GRCm39) unclassified probably benign
R4669:Wrap73 UTSW 4 154,236,153 (GRCm39) missense probably benign 0.26
R4969:Wrap73 UTSW 4 154,237,138 (GRCm39) missense probably damaging 1.00
R5254:Wrap73 UTSW 4 154,239,803 (GRCm39) missense probably benign 0.00
R5334:Wrap73 UTSW 4 154,229,731 (GRCm39) missense probably damaging 0.97
R5428:Wrap73 UTSW 4 154,229,731 (GRCm39) missense probably damaging 0.97
R5431:Wrap73 UTSW 4 154,229,731 (GRCm39) missense probably damaging 0.97
R5728:Wrap73 UTSW 4 154,239,099 (GRCm39) critical splice donor site probably null
R7338:Wrap73 UTSW 4 154,237,043 (GRCm39) missense probably benign 0.26
R7426:Wrap73 UTSW 4 154,240,584 (GRCm39) missense probably damaging 1.00
R7480:Wrap73 UTSW 4 154,237,043 (GRCm39) missense probably benign 0.26
R7680:Wrap73 UTSW 4 154,241,079 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCACTGTGCAAGAACAGGGCTTAC -3'
(R):5'- TTAAGCAGGTCAGCCTGTCTGAGG -3'

Sequencing Primer
(F):5'- tcccacccatacaaatccttc -3'
(R):5'- GCCTGTCTGAGGCCAGC -3'
Posted On 2013-06-12