Incidental Mutation 'R0533:Cux1'
ID 49315
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Name cut-like homeobox 1
Synonyms CDP, Cutl1, Cux, Cux-1
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.892) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 136276989-136596344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 136336713 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 925 (E925G)
Ref Sequence ENSEMBL: ENSMUSP00000135892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000004097
AA Change: E842G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: E842G

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148082
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175975
AA Change: E920G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: E920G

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176172
AA Change: E933G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: E933G

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176486
AA Change: E804G
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: E804G

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176778
AA Change: E925G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: E925G

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Meta Mutation Damage Score 0.3778 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136,355,650 (GRCm39) missense probably damaging 1.00
IGL00966:Cux1 APN 5 136,340,345 (GRCm39) intron probably benign
IGL01129:Cux1 APN 5 136,333,572 (GRCm39) intron probably benign
IGL01885:Cux1 APN 5 136,337,301 (GRCm39) missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136,303,979 (GRCm39) missense probably benign 0.04
IGL02259:Cux1 APN 5 136,355,687 (GRCm39) missense probably damaging 1.00
IGL02666:Cux1 APN 5 136,304,169 (GRCm39) nonsense probably null
IGL02826:Cux1 APN 5 136,336,857 (GRCm39) missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136,594,379 (GRCm39) intron probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0057:Cux1 UTSW 5 136,285,136 (GRCm39) missense probably damaging 1.00
R0149:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0295:Cux1 UTSW 5 136,342,066 (GRCm39) missense probably benign 0.04
R0361:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0630:Cux1 UTSW 5 136,315,689 (GRCm39) missense probably damaging 1.00
R0801:Cux1 UTSW 5 136,355,783 (GRCm39) missense probably damaging 0.97
R0884:Cux1 UTSW 5 136,336,689 (GRCm39) missense probably damaging 1.00
R0976:Cux1 UTSW 5 136,342,144 (GRCm39) missense probably damaging 1.00
R1073:Cux1 UTSW 5 136,281,395 (GRCm39) critical splice donor site probably null
R1222:Cux1 UTSW 5 136,304,003 (GRCm39) missense probably benign 0.18
R1518:Cux1 UTSW 5 136,337,133 (GRCm39) missense probably benign 0.29
R1686:Cux1 UTSW 5 136,304,235 (GRCm39) nonsense probably null
R1687:Cux1 UTSW 5 136,341,523 (GRCm39) missense probably damaging 1.00
R1758:Cux1 UTSW 5 136,421,176 (GRCm39) missense probably damaging 1.00
R1797:Cux1 UTSW 5 136,304,169 (GRCm39) missense probably benign 0.22
R1919:Cux1 UTSW 5 136,392,173 (GRCm39) nonsense probably null
R2051:Cux1 UTSW 5 136,361,512 (GRCm39) missense probably damaging 1.00
R2339:Cux1 UTSW 5 136,315,862 (GRCm39) missense probably damaging 1.00
R3438:Cux1 UTSW 5 136,340,414 (GRCm39) missense probably damaging 0.97
R3713:Cux1 UTSW 5 136,594,397 (GRCm39) intron probably benign
R3800:Cux1 UTSW 5 136,344,887 (GRCm39) missense probably damaging 1.00
R3964:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R4135:Cux1 UTSW 5 136,336,750 (GRCm39) missense probably damaging 1.00
R4198:Cux1 UTSW 5 136,315,702 (GRCm39) missense probably damaging 1.00
R4467:Cux1 UTSW 5 136,341,576 (GRCm39) missense probably damaging 1.00
R4498:Cux1 UTSW 5 136,341,847 (GRCm39) missense probably damaging 1.00
R4622:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4623:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4651:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4652:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4658:Cux1 UTSW 5 136,279,448 (GRCm39) missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136,315,653 (GRCm39) missense probably damaging 1.00
R4704:Cux1 UTSW 5 136,278,055 (GRCm39) missense probably benign 0.01
R4867:Cux1 UTSW 5 136,303,815 (GRCm39) intron probably benign
R4965:Cux1 UTSW 5 136,340,410 (GRCm39) missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136,342,054 (GRCm39) missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136,594,295 (GRCm39) intron probably benign
R5226:Cux1 UTSW 5 136,399,027 (GRCm39) missense probably benign 0.01
R5252:Cux1 UTSW 5 136,337,151 (GRCm39) missense probably damaging 0.98
R5266:Cux1 UTSW 5 136,341,548 (GRCm39) missense probably damaging 1.00
R5399:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136,304,171 (GRCm39) missense probably benign 0.13
R5609:Cux1 UTSW 5 136,421,174 (GRCm39) missense probably damaging 1.00
R5681:Cux1 UTSW 5 136,337,038 (GRCm39) missense probably damaging 1.00
R5993:Cux1 UTSW 5 136,392,125 (GRCm39) missense probably benign 0.00
R6049:Cux1 UTSW 5 136,361,564 (GRCm39) missense probably damaging 1.00
R6290:Cux1 UTSW 5 136,340,412 (GRCm39) missense probably damaging 0.99
R6310:Cux1 UTSW 5 136,304,018 (GRCm39) missense probably benign 0.10
R6351:Cux1 UTSW 5 136,338,646 (GRCm39) missense probably damaging 1.00
R6531:Cux1 UTSW 5 136,303,973 (GRCm39) missense probably benign 0.03
R6590:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6663:Cux1 UTSW 5 136,514,701 (GRCm39) missense probably damaging 1.00
R6690:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6777:Cux1 UTSW 5 136,594,422 (GRCm39) intron probably benign
R6786:Cux1 UTSW 5 136,596,085 (GRCm39) missense probably damaging 1.00
R6817:Cux1 UTSW 5 136,402,027 (GRCm39) splice site probably null
R6989:Cux1 UTSW 5 136,308,502 (GRCm39) nonsense probably null
R7011:Cux1 UTSW 5 136,388,887 (GRCm39) missense probably damaging 1.00
R7167:Cux1 UTSW 5 136,338,895 (GRCm39) splice site probably null
R7699:Cux1 UTSW 5 136,514,593 (GRCm39) critical splice donor site probably null
R7861:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136,392,161 (GRCm39) missense probably benign 0.00
R7916:Cux1 UTSW 5 136,311,815 (GRCm39) missense probably damaging 1.00
R8023:Cux1 UTSW 5 136,402,251 (GRCm39) missense probably damaging 0.99
R8154:Cux1 UTSW 5 136,281,434 (GRCm39) missense probably damaging 1.00
R8267:Cux1 UTSW 5 136,311,853 (GRCm39) missense probably damaging 1.00
R8289:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8305:Cux1 UTSW 5 136,388,863 (GRCm39) missense probably benign 0.02
R8319:Cux1 UTSW 5 136,594,251 (GRCm39) missense probably benign 0.02
R8405:Cux1 UTSW 5 136,304,241 (GRCm39) missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136,303,944 (GRCm39) missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8671:Cux1 UTSW 5 136,279,454 (GRCm39) missense probably damaging 1.00
R8680:Cux1 UTSW 5 136,336,710 (GRCm39) missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R8738:Cux1 UTSW 5 136,402,220 (GRCm39) missense probably damaging 1.00
R8793:Cux1 UTSW 5 136,594,539 (GRCm39) missense unknown
R8897:Cux1 UTSW 5 136,315,623 (GRCm39) missense probably damaging 1.00
R8926:Cux1 UTSW 5 136,338,404 (GRCm39) intron probably benign
R8954:Cux1 UTSW 5 136,402,203 (GRCm39) nonsense probably null
R9092:Cux1 UTSW 5 136,514,671 (GRCm39) missense probably damaging 1.00
R9205:Cux1 UTSW 5 136,398,989 (GRCm39) missense probably damaging 1.00
R9550:Cux1 UTSW 5 136,340,387 (GRCm39) missense probably damaging 0.99
R9578:Cux1 UTSW 5 136,282,919 (GRCm39) critical splice donor site probably null
R9682:Cux1 UTSW 5 136,337,116 (GRCm39) missense probably benign
R9701:Cux1 UTSW 5 136,343,169 (GRCm39) missense probably damaging 0.97
R9712:Cux1 UTSW 5 136,338,673 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGCACAATGGGACTCAGCAGAC -3'
(R):5'- CAGCATCCGCAGAGTACTGGAAAG -3'

Sequencing Primer
(F):5'- CTAGGACACTTGCCAGTGG -3'
(R):5'- CAGAGTACTGGAAAGAGTGGC -3'
Posted On 2013-06-12