Mutagenetix > Incidental Mutation

Incidental Mutation 'R0533:Cux1'

49315

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

MMRRC Submission

038725-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.838) question?

Stock #

R0533 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136307859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 925 (E925G)

Ref Sequence

ENSEMBL: ENSMUSP00000135892 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004097
AA Change: E842G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: E842G

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
CUT	452	538	5.06e-39	SMART
low complexity region	602	608	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
CUT	841	929	3.31e-43	SMART
low complexity region	956	972	N/A	INTRINSIC
low complexity region	990	1011	N/A	INTRINSIC
CUT	1024	1110	3.78e-38	SMART
HOX	1150	1212	6.32e-15	SMART
low complexity region	1224	1239	N/A	INTRINSIC
low complexity region	1317	1379	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148082

Predicted Effect

probably benign
Transcript: ENSMUST00000175918

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175975
AA Change: E920G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: E920G

Domain	Start	End	E-Value	Type
coiled coil region	1	169	N/A	INTRINSIC
low complexity region	235	251	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	331	342	N/A	INTRINSIC
CUT	358	444	5.06e-39	SMART
low complexity region	508	514	N/A	INTRINSIC
low complexity region	526	548	N/A	INTRINSIC
CUT	747	835	3.31e-43	SMART
low complexity region	862	878	N/A	INTRINSIC
low complexity region	896	917	N/A	INTRINSIC
CUT	930	1016	3.78e-38	SMART
HOX	1056	1118	6.32e-15	SMART
low complexity region	1130	1145	N/A	INTRINSIC
low complexity region	1223	1285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175998

SMART Domains

Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	39	N/A	INTRINSIC
low complexity region	52	64	N/A	INTRINSIC
coiled coil region	76	148	N/A	INTRINSIC
Pfam:CASP_C	204	430	8.6e-72	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176172
AA Change: E933G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: E933G

Domain	Start	End	E-Value	Type
coiled coil region	99	354	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC
low complexity region	462	474	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
CUT	543	629	5.06e-39	SMART
low complexity region	693	699	N/A	INTRINSIC
low complexity region	711	733	N/A	INTRINSIC
CUT	932	1020	3.31e-43	SMART
low complexity region	1047	1063	N/A	INTRINSIC
low complexity region	1081	1102	N/A	INTRINSIC
CUT	1115	1201	3.78e-38	SMART
HOX	1241	1303	6.32e-15	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1408	1470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176216

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000176486
AA Change: E804G

SMART Domains

Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: E804G

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
low complexity region	429	445	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
low complexity region	525	536	N/A	INTRINSIC
CUT	552	638	5.06e-39	SMART
Blast:CUT	641	840	3e-50	BLAST
CUT	919	1007	3.31e-43	SMART
low complexity region	1034	1050	N/A	INTRINSIC
low complexity region	1068	1089	N/A	INTRINSIC
CUT	1102	1188	3.78e-38	SMART
HOX	1228	1290	6.32e-15	SMART
low complexity region	1302	1317	N/A	INTRINSIC
low complexity region	1395	1457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176745

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176778
AA Change: E925G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: E925G

Domain	Start	End	E-Value	Type
low complexity region	78	86	N/A	INTRINSIC
coiled coil region	195	448	N/A	INTRINSIC
low complexity region	508	519	N/A	INTRINSIC
CUT	535	621	5.06e-39	SMART
low complexity region	685	691	N/A	INTRINSIC
low complexity region	703	725	N/A	INTRINSIC
CUT	924	1012	3.31e-43	SMART
low complexity region	1039	1055	N/A	INTRINSIC
low complexity region	1073	1094	N/A	INTRINSIC
CUT	1107	1193	3.78e-38	SMART
HOX	1233	1295	6.32e-15	SMART
low complexity region	1307	1322	N/A	INTRINSIC
low complexity region	1400	1462	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177297

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Meta Mutation Damage Score

0.3778

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (57/57)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	G	8: 60,531,763		probably benign	Het
Abcb1b	A	T	5: 8,864,113		probably null	Het
Adcy10	A	G	1: 165,564,023	N1283S	probably benign	Het
Adgrb1	T	A	15: 74,541,559	W531R	probably damaging	Het
Ago4	A	G	4: 126,516,860	V246A	probably benign	Het
Arid5b	A	T	10: 68,186,033	D242E	probably damaging	Het
Arpp21	A	G	9: 112,126,505	V522A	probably benign	Het
Atg4b	T	A	1: 93,784,910		probably benign	Het
Capn12	T	C	7: 28,887,683	F359S	possibly damaging	Het
Ccdc88c	A	T	12: 100,954,282	I360N	probably damaging	Het
Clic3	A	G	2: 25,458,138	Y99C	probably damaging	Het
Dnah10	G	A	5: 124,775,250		probably null	Het
Dnah17	A	G	11: 118,110,537	V860A	possibly damaging	Het
Etv5	C	T	16: 22,436,075		probably benign	Het
Fam83a	T	A	15: 58,009,811	N345K	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gm13089	G	T	4: 143,698,020	C284*	probably null	Het
Gpm6a	A	G	8: 55,055,374		probably null	Het
Grid1	T	A	14: 35,309,385	Y312N	possibly damaging	Het
Gstm4	T	C	3: 108,043,525	N51S	probably benign	Het
Hid1	A	T	11: 115,348,809	I765N	probably damaging	Het
Hmmr	A	G	11: 40,709,989	V518A	unknown	Het
Itgb6	A	G	2: 60,669,197	V84A	probably benign	Het
Kbtbd4	A	G	2: 90,907,604	K233E	probably benign	Het
Kif15	A	T	9: 123,009,433		probably benign	Het
Klre1	T	C	6: 129,583,193	S143P	probably damaging	Het
Krt81	T	C	15: 101,461,389	D216G	probably benign	Het
Mctp2	G	T	7: 72,080,822	H868Q	probably benign	Het
Morc2b	G	C	17: 33,135,932	Y955*	probably null	Het
Myog	A	C	1: 134,290,473	N140H	possibly damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Neil3	A	T	8: 53,638,775		probably null	Het
Nrg1	T	C	8: 31,831,245		probably null	Het
Olfr681	G	A	7: 105,122,350	V298I	probably benign	Het
Olfr689	A	T	7: 105,314,372	M123L	probably benign	Het
Olfr99	A	T	17: 37,280,291	L43*	probably null	Het
Pramef25	A	T	4: 143,950,720	D96E	possibly damaging	Het
Ptger2	T	A	14: 44,988,982	N6K	possibly damaging	Het
Ryr1	T	A	7: 29,078,780	E2097V	probably damaging	Het
Sel1l	A	T	12: 91,820,094	F397Y	probably damaging	Het
Skint5	A	G	4: 113,827,867	V551A	unknown	Het
Slc39a12	A	G	2: 14,400,331	T245A	probably benign	Het
Syne1	C	T	10: 5,358,438	V706I	probably benign	Het
Tbc1d8	G	T	1: 39,372,774	Q994K	possibly damaging	Het
Tnrc6b	C	T	15: 80,876,653	T187I	probably benign	Het
Ttll6	G	A	11: 96,154,756	A600T	probably benign	Het
Ust	T	C	10: 8,248,080		probably benign	Het
Vmn2r71	GT	GTT	7: 85,619,218		probably null	Het
Vstm2a	C	T	11: 16,263,041	A142V	probably damaging	Het
Wfs1	T	A	5: 36,973,722		probably benign	Het
Wrap73	G	A	4: 154,151,649	G145D	probably damaging	Het
Wrap73	G	A	4: 154,156,154	V368M	possibly damaging	Het
Xrra1	T	A	7: 99,875,145		probably null	Het
Zfhx2	C	T	14: 55,064,090	V2146I	probably benign	Het
Zfp335	A	T	2: 164,907,922	L185*	probably null	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2051:Cux1	UTSW	5	136332658	missense	probably damaging	1.00
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3713:Cux1	UTSW	5	136565543	intron	probably benign
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4135:Cux1	UTSW	5	136307896	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4651:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R4965:Cux1	UTSW	5	136311556	missense	possibly damaging	0.77
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8483:Cux1	UTSW	5	136275090	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8671:Cux1	UTSW	5	136250600	missense	probably damaging	1.00
R8680:Cux1	UTSW	5	136307856	missense	possibly damaging	0.46
R8737:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R8738:Cux1	UTSW	5	136373366	missense	probably damaging	1.00
R8793:Cux1	UTSW	5	136565685	missense	unknown
R8897:Cux1	UTSW	5	136286769	missense	probably damaging	1.00
R8926:Cux1	UTSW	5	136309550	intron	probably benign
R8954:Cux1	UTSW	5	136373349	nonsense	probably null
R9092:Cux1	UTSW	5	136485817	missense	probably damaging	1.00
R9205:Cux1	UTSW	5	136370135	missense	probably damaging	1.00
R9550:Cux1	UTSW	5	136311533	missense	probably damaging	0.99
R9578:Cux1	UTSW	5	136254065	critical splice donor site	probably null
R9682:Cux1	UTSW	5	136308262	missense	probably benign
R9701:Cux1	UTSW	5	136314315	missense	probably damaging	0.97
R9712:Cux1	UTSW	5	136309819	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TGCACAATGGGACTCAGCAGAC -3'
(R):5'- CAGCATCCGCAGAGTACTGGAAAG -3'

Sequencing Primer
(F):5'- CTAGGACACTTGCCAGTGG -3'
(R):5'- CAGAGTACTGGAAAGAGTGGC -3'

Posted On

2013-06-12