Incidental Mutation 'R0533:Capn12'
ID 49317
Institutional Source Beutler Lab
Gene Symbol Capn12
Ensembl Gene ENSMUSG00000054083
Gene Name calpain 12
Synonyms
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0533 (G1)
Quality Score 124
Status Validated
Chromosome 7
Chromosomal Location 28580890-28593010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28587108 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 359 (F359S)
Ref Sequence ENSEMBL: ENSMUSP00000069055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066880]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000066880
AA Change: F359S

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069055
Gene: ENSMUSG00000054083
AA Change: F359S

DomainStartEndE-ValueType
CysPc 27 349 7.8e-139 SMART
calpain_III 353 529 7.47e-72 SMART
SCOP:d1alva_ 552 720 3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208299
Meta Mutation Damage Score 0.3146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Capn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Capn12 APN 7 28,588,530 (GRCm39) missense probably benign
IGL01758:Capn12 APN 7 28,586,048 (GRCm39) splice site probably null
IGL02381:Capn12 APN 7 28,585,880 (GRCm39) splice site probably benign
IGL02863:Capn12 APN 7 28,582,581 (GRCm39) missense probably damaging 1.00
IGL03237:Capn12 APN 7 28,590,366 (GRCm39) missense probably damaging 1.00
PIT4418001:Capn12 UTSW 7 28,585,961 (GRCm39) missense probably benign 0.06
R0027:Capn12 UTSW 7 28,581,385 (GRCm39) missense probably benign 0.01
R0047:Capn12 UTSW 7 28,589,812 (GRCm39) critical splice donor site probably null
R0047:Capn12 UTSW 7 28,589,812 (GRCm39) critical splice donor site probably null
R0070:Capn12 UTSW 7 28,588,551 (GRCm39) unclassified probably benign
R0070:Capn12 UTSW 7 28,588,551 (GRCm39) unclassified probably benign
R0932:Capn12 UTSW 7 28,587,123 (GRCm39) missense possibly damaging 0.91
R1524:Capn12 UTSW 7 28,582,189 (GRCm39) splice site probably benign
R4758:Capn12 UTSW 7 28,592,148 (GRCm39) missense possibly damaging 0.66
R4793:Capn12 UTSW 7 28,592,094 (GRCm39) missense probably benign 0.23
R4983:Capn12 UTSW 7 28,589,795 (GRCm39) missense probably benign 0.00
R5560:Capn12 UTSW 7 28,582,285 (GRCm39) missense probably benign 0.01
R5835:Capn12 UTSW 7 28,581,383 (GRCm39) missense probably benign 0.05
R5886:Capn12 UTSW 7 28,587,030 (GRCm39) missense probably benign 0.01
R6247:Capn12 UTSW 7 28,588,077 (GRCm39) missense probably benign 0.05
R6441:Capn12 UTSW 7 28,587,427 (GRCm39) missense probably benign 0.00
R7136:Capn12 UTSW 7 28,582,532 (GRCm39) splice site probably null
R7757:Capn12 UTSW 7 28,582,246 (GRCm39) missense probably damaging 1.00
R8329:Capn12 UTSW 7 28,582,626 (GRCm39) missense probably damaging 1.00
R8888:Capn12 UTSW 7 28,585,949 (GRCm39) splice site probably benign
R8924:Capn12 UTSW 7 28,582,628 (GRCm39) missense probably damaging 1.00
R9150:Capn12 UTSW 7 28,590,378 (GRCm39) missense probably benign 0.11
R9209:Capn12 UTSW 7 28,581,243 (GRCm39) missense probably damaging 1.00
Z1177:Capn12 UTSW 7 28,587,253 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGAGGACTTGGAGACATTGCC -3'
(R):5'- ATGAGTGACAACAGGACCGTGC -3'

Sequencing Primer
(F):5'- CTTTAGGGAACTGGGGGCAC -3'
(R):5'- TCATCAGGCTCCAGCAGTG -3'
Posted On 2013-06-12