Incidental Mutation 'R0533:Capn12'
ID 49317
Institutional Source Beutler Lab
Gene Symbol Capn12
Ensembl Gene ENSMUSG00000054083
Gene Name calpain 12
Synonyms
MMRRC Submission 038725-MU
Accession Numbers

Ncbi RefSeq: NM_001110807.1; MGI: 1891369

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0533 (G1)
Quality Score 124
Status Validated
Chromosome 7
Chromosomal Location 28881422-28893563 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28887683 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 359 (F359S)
Ref Sequence ENSEMBL: ENSMUSP00000069055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066880]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000066880
AA Change: F359S

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069055
Gene: ENSMUSG00000054083
AA Change: F359S

DomainStartEndE-ValueType
CysPc 27 349 7.8e-139 SMART
calpain_III 353 529 7.47e-72 SMART
SCOP:d1alva_ 552 720 3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208299
Meta Mutation Damage Score 0.3146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Capn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Capn12 APN 7 28889105 missense probably benign
IGL01758:Capn12 APN 7 28886623 splice site probably null
IGL02381:Capn12 APN 7 28886455 splice site probably benign
IGL02863:Capn12 APN 7 28883156 missense probably damaging 1.00
IGL03237:Capn12 APN 7 28890941 missense probably damaging 1.00
PIT4418001:Capn12 UTSW 7 28886536 missense probably benign 0.06
R0027:Capn12 UTSW 7 28881960 missense probably benign 0.01
R0047:Capn12 UTSW 7 28890387 critical splice donor site probably null
R0047:Capn12 UTSW 7 28890387 critical splice donor site probably null
R0070:Capn12 UTSW 7 28889126 unclassified probably benign
R0070:Capn12 UTSW 7 28889126 unclassified probably benign
R0932:Capn12 UTSW 7 28887698 missense possibly damaging 0.91
R1524:Capn12 UTSW 7 28882764 splice site probably benign
R4758:Capn12 UTSW 7 28892723 missense possibly damaging 0.66
R4793:Capn12 UTSW 7 28892669 missense probably benign 0.23
R4983:Capn12 UTSW 7 28890370 missense probably benign 0.00
R5560:Capn12 UTSW 7 28882860 missense probably benign 0.01
R5835:Capn12 UTSW 7 28881958 missense probably benign 0.05
R5886:Capn12 UTSW 7 28887605 missense probably benign 0.01
R6247:Capn12 UTSW 7 28888652 missense probably benign 0.05
R6441:Capn12 UTSW 7 28888002 missense probably benign 0.00
R7136:Capn12 UTSW 7 28883107 splice site probably null
R7757:Capn12 UTSW 7 28882821 missense probably damaging 1.00
R8329:Capn12 UTSW 7 28883201 missense probably damaging 1.00
R8888:Capn12 UTSW 7 28886524 splice site probably benign
R8924:Capn12 UTSW 7 28883203 missense probably damaging 1.00
R9150:Capn12 UTSW 7 28890953 missense probably benign 0.11
R9209:Capn12 UTSW 7 28881818 missense probably damaging 1.00
Z1177:Capn12 UTSW 7 28887828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGAGGACTTGGAGACATTGCC -3'
(R):5'- ATGAGTGACAACAGGACCGTGC -3'

Sequencing Primer
(F):5'- CTTTAGGGAACTGGGGGCAC -3'
(R):5'- TCATCAGGCTCCAGCAGTG -3'
Posted On 2013-06-12