Incidental Mutation 'R0533:Or56b35'
ID 49322
Institutional Source Beutler Lab
Gene Symbol Or56b35
Ensembl Gene ENSMUSG00000073907
Gene Name olfactory receptor family 56 subfamily B member 35
Synonyms Olfr689, MOR40-3, GA_x6K02T2PBJ9-7942985-7943947
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 104963213-104964175 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104963579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 123 (M123L)
Ref Sequence ENSEMBL: ENSMUSP00000151049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098153] [ENSMUST00000215413]
AlphaFold Q8VG18
Predicted Effect probably benign
Transcript: ENSMUST00000098153
AA Change: M123L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095756
Gene: ENSMUSG00000073907
AA Change: M123L

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 4.3e-74 PFAM
Pfam:7TM_GPCR_Srsx 40 311 3.9e-8 PFAM
Pfam:7tm_1 46 296 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215413
AA Change: M123L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Or56b35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Or56b35 APN 7 104,963,439 (GRCm39) missense probably damaging 0.99
R0320:Or56b35 UTSW 7 104,963,861 (GRCm39) missense probably benign 0.24
R3499:Or56b35 UTSW 7 104,963,607 (GRCm39) missense probably damaging 1.00
R5326:Or56b35 UTSW 7 104,963,646 (GRCm39) missense probably damaging 1.00
R5424:Or56b35 UTSW 7 104,963,778 (GRCm39) missense possibly damaging 0.96
R5595:Or56b35 UTSW 7 104,963,213 (GRCm39) start codon destroyed probably benign
R5905:Or56b35 UTSW 7 104,964,158 (GRCm39) missense probably benign
R6139:Or56b35 UTSW 7 104,963,453 (GRCm39) missense probably damaging 0.99
R6230:Or56b35 UTSW 7 104,963,289 (GRCm39) missense possibly damaging 0.59
R6259:Or56b35 UTSW 7 104,963,264 (GRCm39) missense probably benign 0.01
R7471:Or56b35 UTSW 7 104,963,712 (GRCm39) missense probably damaging 1.00
R7747:Or56b35 UTSW 7 104,963,654 (GRCm39) missense probably damaging 0.99
R9282:Or56b35 UTSW 7 104,963,781 (GRCm39) missense probably benign
R9769:Or56b35 UTSW 7 104,963,933 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGAGCCTAACCTGCATCAGTC -3'
(R):5'- CCCCAAGTTAGAGCAAAGGCAGTG -3'

Sequencing Primer
(F):5'- CCTGCATCAGTCAATGTATCAG -3'
(R):5'- AGCAAAGGCAGTGGTCTATTTC -3'
Posted On 2013-06-12