Mutagenetix > Incidental Mutation

Incidental Mutation 'R0533:Arid5b'

49330

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT rich interactive domain 5B (MRF1-like)

Synonyms

5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt

MMRRC Submission

038725-MU

Accession Numbers

Genbank: NM_023598; MGI: 2175912

Essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R0533 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68092520-68278740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68186033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 242 (D242E)

Ref Sequence

ENSEMBL: ENSMUSP00000020106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

probably damaging
Transcript: ENSMUST00000020106
AA Change: D242E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947
AA Change: D242E

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218425

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219238
AA Change: D242E

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.1173

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	G	8: 60,531,763		probably benign	Het
Abcb1b	A	T	5: 8,864,113		probably null	Het
Adcy10	A	G	1: 165,564,023	N1283S	probably benign	Het
Adgrb1	T	A	15: 74,541,559	W531R	probably damaging	Het
Ago4	A	G	4: 126,516,860	V246A	probably benign	Het
Arpp21	A	G	9: 112,126,505	V522A	probably benign	Het
Atg4b	T	A	1: 93,784,910		probably benign	Het
Capn12	T	C	7: 28,887,683	F359S	possibly damaging	Het
Ccdc88c	A	T	12: 100,954,282	I360N	probably damaging	Het
Clic3	A	G	2: 25,458,138	Y99C	probably damaging	Het
Cux1	T	C	5: 136,307,859	E925G	probably damaging	Het
Dnah10	G	A	5: 124,775,250		probably null	Het
Dnah17	A	G	11: 118,110,537	V860A	possibly damaging	Het
Etv5	C	T	16: 22,436,075		probably benign	Het
Fam83a	T	A	15: 58,009,811	N345K	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gm13089	G	T	4: 143,698,020	C284*	probably null	Het
Gpm6a	A	G	8: 55,055,374		probably null	Het
Grid1	T	A	14: 35,309,385	Y312N	possibly damaging	Het
Gstm4	T	C	3: 108,043,525	N51S	probably benign	Het
Hid1	A	T	11: 115,348,809	I765N	probably damaging	Het
Hmmr	A	G	11: 40,709,989	V518A	unknown	Het
Itgb6	A	G	2: 60,669,197	V84A	probably benign	Het
Kbtbd4	A	G	2: 90,907,604	K233E	probably benign	Het
Kif15	A	T	9: 123,009,433		probably benign	Het
Klre1	T	C	6: 129,583,193	S143P	probably damaging	Het
Krt81	T	C	15: 101,461,389	D216G	probably benign	Het
Mctp2	G	T	7: 72,080,822	H868Q	probably benign	Het
Morc2b	G	C	17: 33,135,932	Y955*	probably null	Het
Myog	A	C	1: 134,290,473	N140H	possibly damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Neil3	A	T	8: 53,638,775		probably null	Het
Nrg1	T	C	8: 31,831,245		probably null	Het
Olfr681	G	A	7: 105,122,350	V298I	probably benign	Het
Olfr689	A	T	7: 105,314,372	M123L	probably benign	Het
Olfr99	A	T	17: 37,280,291	L43*	probably null	Het
Pramef25	A	T	4: 143,950,720	D96E	possibly damaging	Het
Ptger2	T	A	14: 44,988,982	N6K	possibly damaging	Het
Ryr1	T	A	7: 29,078,780	E2097V	probably damaging	Het
Sel1l	A	T	12: 91,820,094	F397Y	probably damaging	Het
Skint5	A	G	4: 113,827,867	V551A	unknown	Het
Slc39a12	A	G	2: 14,400,331	T245A	probably benign	Het
Syne1	C	T	10: 5,358,438	V706I	probably benign	Het
Tbc1d8	G	T	1: 39,372,774	Q994K	possibly damaging	Het
Tnrc6b	C	T	15: 80,876,653	T187I	probably benign	Het
Ttll6	G	A	11: 96,154,756	A600T	probably benign	Het
Ust	T	C	10: 8,248,080		probably benign	Het
Vmn2r71	GT	GTT	7: 85,619,218		probably null	Het
Vstm2a	C	T	11: 16,263,041	A142V	probably damaging	Het
Wfs1	T	A	5: 36,973,722		probably benign	Het
Wrap73	G	A	4: 154,151,649	G145D	probably damaging	Het
Wrap73	G	A	4: 154,156,154	V368M	possibly damaging	Het
Xrra1	T	A	7: 99,875,145		probably null	Het
Zfhx2	C	T	14: 55,064,090	V2146I	probably benign	Het
Zfp335	A	T	2: 164,907,922	L185*	probably null	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	68128975	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	68097609	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	68097399	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	68096668	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	68101904	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	68101950	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68243227	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	68097457	missense	possibly damaging	0.73
gobi	UTSW	10	68118345	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	68098589	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	68098011	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68278729	utr 5 prime	probably benign
R0525:Arid5b	UTSW	10	68097846	missense	possibly damaging	0.90
R0646:Arid5b	UTSW	10	68096977	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	68098356	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	68097214	nonsense	probably null
R1638:Arid5b	UTSW	10	68277947	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68186067	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68278688	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	68097777	missense	possibly damaging	0.63
R2996:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R2997:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	68096689	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68278110	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68278127	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	68096889	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	68102079	missense	probably damaging	1.00
R6114:Arid5b	UTSW	10	68097744	missense	possibly damaging	0.89
R6313:Arid5b	UTSW	10	68097582	missense	possibly damaging	0.95
R6338:Arid5b	UTSW	10	68098561	nonsense	probably null
R6525:Arid5b	UTSW	10	68097666	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68186212	nonsense	probably null
R7013:Arid5b	UTSW	10	68097819	missense	probably damaging	1.00
R7099:Arid5b	UTSW	10	68098179	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	68097807	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	68128922	missense	probably benign	0.44
R7334:Arid5b	UTSW	10	68243177	missense	possibly damaging	0.61
R7432:Arid5b	UTSW	10	68118266	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68243164	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	68118345	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	68098587	missense	probably benign
R7661:Arid5b	UTSW	10	68098587	missense	probably benign
R7662:Arid5b	UTSW	10	68098587	missense	probably benign
R7663:Arid5b	UTSW	10	68098587	missense	probably benign
R7665:Arid5b	UTSW	10	68098587	missense	probably benign
R7666:Arid5b	UTSW	10	68098587	missense	probably benign
R7759:Arid5b	UTSW	10	68097802	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	68096776	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	68098587	missense	probably benign
R7789:Arid5b	UTSW	10	68098587	missense	probably benign
R7875:Arid5b	UTSW	10	68128941	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	68098356	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68186152	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68278706	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	68097387	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	68097810	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	68098278	missense
R8954:Arid5b	UTSW	10	68101980	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	68128798	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	68102052	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68186257	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	68118302	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	68097228	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCGTTCACCTGCGGTAAACTGAGG -3'
(R):5'- TGCTGCCAAGTGACACAGACATC -3'

Sequencing Primer
(F):5'- TAAACTGAGGCCGCCAAG -3'
(R):5'- CAGAAGAAGGTGTCTCTATTGCC -3'

Posted On

2013-06-12