Incidental Mutation 'R0533:Hmmr'
ID 49332
Institutional Source Beutler Lab
Gene Symbol Hmmr
Ensembl Gene ENSMUSG00000020330
Gene Name hyaluronan mediated motility receptor (RHAMM)
Synonyms CD168, Rhamm
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 40592222-40624249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40600816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 518 (V518A)
Ref Sequence ENSEMBL: ENSMUSP00000020579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020579]
AlphaFold Q00547
Predicted Effect unknown
Transcript: ENSMUST00000020579
AA Change: V518A
SMART Domains Protein: ENSMUSP00000020579
Gene: ENSMUSG00000020330
AA Change: V518A

DomainStartEndE-ValueType
Pfam:HMMR_N 15 339 1.2e-136 PFAM
low complexity region 375 385 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
Blast:MA 452 578 7e-6 BLAST
Pfam:HMMR_C 636 789 4.3e-71 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit impaired fertility and are less susceptible to the formation of aggressive fibromatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Hmmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:Hmmr APN 11 40,612,561 (GRCm39) missense probably benign 0.25
IGL02096:Hmmr APN 11 40,598,256 (GRCm39) missense probably benign 0.02
IGL02224:Hmmr APN 11 40,600,831 (GRCm39) missense unknown
IGL02527:Hmmr APN 11 40,598,932 (GRCm39) missense probably damaging 1.00
IGL02870:Hmmr APN 11 40,604,902 (GRCm39) missense possibly damaging 0.63
IGL03175:Hmmr APN 11 40,605,636 (GRCm39) missense probably benign 0.02
IGL03327:Hmmr APN 11 40,606,242 (GRCm39) missense probably damaging 1.00
R0126:Hmmr UTSW 11 40,596,781 (GRCm39) missense probably damaging 1.00
R0211:Hmmr UTSW 11 40,605,635 (GRCm39) missense probably damaging 0.96
R0610:Hmmr UTSW 11 40,606,729 (GRCm39) missense probably damaging 1.00
R0747:Hmmr UTSW 11 40,612,572 (GRCm39) splice site probably benign
R1909:Hmmr UTSW 11 40,598,925 (GRCm39) missense probably damaging 1.00
R2013:Hmmr UTSW 11 40,619,259 (GRCm39) missense possibly damaging 0.85
R4446:Hmmr UTSW 11 40,606,148 (GRCm39) missense probably damaging 1.00
R4897:Hmmr UTSW 11 40,619,261 (GRCm39) missense probably benign 0.00
R4937:Hmmr UTSW 11 40,612,667 (GRCm39) missense possibly damaging 0.90
R5795:Hmmr UTSW 11 40,612,733 (GRCm39) missense probably damaging 1.00
R5873:Hmmr UTSW 11 40,598,527 (GRCm39) missense probably damaging 0.99
R6414:Hmmr UTSW 11 40,606,694 (GRCm39) critical splice donor site probably null
R6962:Hmmr UTSW 11 40,598,242 (GRCm39) missense probably damaging 1.00
R7391:Hmmr UTSW 11 40,598,613 (GRCm39) splice site probably null
R7558:Hmmr UTSW 11 40,624,156 (GRCm39) missense probably damaging 1.00
R7965:Hmmr UTSW 11 40,606,256 (GRCm39) splice site probably null
R8065:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8066:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8255:Hmmr UTSW 11 40,598,262 (GRCm39) missense probably damaging 1.00
R8303:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8304:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8306:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8307:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8308:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8387:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8743:Hmmr UTSW 11 40,598,858 (GRCm39) missense probably damaging 1.00
R8817:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8820:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8829:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8831:Hmmr UTSW 11 40,612,499 (GRCm39) missense probably damaging 1.00
R8838:Hmmr UTSW 11 40,604,854 (GRCm39) missense probably benign 0.00
R9312:Hmmr UTSW 11 40,614,316 (GRCm39) missense possibly damaging 0.77
R9453:Hmmr UTSW 11 40,612,655 (GRCm39) critical splice donor site probably null
R9468:Hmmr UTSW 11 40,614,314 (GRCm39) nonsense probably null
R9601:Hmmr UTSW 11 40,598,210 (GRCm39) nonsense probably null
T0975:Hmmr UTSW 11 40,614,243 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGCAGCCATCATCCACTGGAG -3'
(R):5'- GCCCAAGCCATCTTGATTGCAC -3'

Sequencing Primer
(F):5'- ACCTTTCCAACTGAGCAGTG -3'
(R):5'- GCCATCTTGATTGCACAAGAG -3'
Posted On 2013-06-12