Incidental Mutation 'R0533:Hid1'
ID 49335
Institutional Source Beutler Lab
Gene Symbol Hid1
Ensembl Gene ENSMUSG00000034586
Gene Name HID1 domain containing
Synonyms C630004H02Rik
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 115238533-115258582 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115239635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 765 (I765N)
Ref Sequence ENSEMBL: ENSMUSP00000102152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000044152] [ENSMUST00000106542] [ENSMUST00000106543]
AlphaFold Q8R1F6
Predicted Effect probably benign
Transcript: ENSMUST00000019006
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044152
AA Change: I764N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043789
Gene: ENSMUSG00000034586
AA Change: I764N

DomainStartEndE-ValueType
Pfam:Dymeclin 1 763 3.9e-242 PFAM
Pfam:Hid1 1 784 3.1e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106542
AA Change: I765N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102152
Gene: ENSMUSG00000034586
AA Change: I765N

DomainStartEndE-ValueType
Pfam:Dymeclin 1 764 7.5e-275 PFAM
Pfam:Hid1 1 785 2.3e-261 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106543
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146256
Meta Mutation Damage Score 0.8257 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Hid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Hid1 APN 11 115,249,895 (GRCm39) missense probably benign 0.05
IGL00783:Hid1 APN 11 115,239,336 (GRCm39) missense probably damaging 1.00
IGL00935:Hid1 APN 11 115,239,324 (GRCm39) missense probably damaging 1.00
IGL02081:Hid1 APN 11 115,239,332 (GRCm39) missense possibly damaging 0.94
IGL02383:Hid1 APN 11 115,243,446 (GRCm39) missense probably damaging 1.00
IGL02637:Hid1 APN 11 115,241,421 (GRCm39) missense probably damaging 0.97
IGL03174:Hid1 APN 11 115,251,215 (GRCm39) missense probably damaging 1.00
R0124:Hid1 UTSW 11 115,247,649 (GRCm39) missense probably damaging 1.00
R1027:Hid1 UTSW 11 115,246,251 (GRCm39) missense probably damaging 1.00
R1069:Hid1 UTSW 11 115,247,591 (GRCm39) missense probably damaging 1.00
R1171:Hid1 UTSW 11 115,243,543 (GRCm39) missense probably benign
R1583:Hid1 UTSW 11 115,247,576 (GRCm39) missense possibly damaging 0.51
R1689:Hid1 UTSW 11 115,251,183 (GRCm39) missense probably damaging 1.00
R1746:Hid1 UTSW 11 115,245,464 (GRCm39) missense probably damaging 0.98
R1772:Hid1 UTSW 11 115,239,299 (GRCm39) missense probably damaging 0.97
R1773:Hid1 UTSW 11 115,239,336 (GRCm39) missense probably damaging 1.00
R1831:Hid1 UTSW 11 115,239,729 (GRCm39) missense probably damaging 1.00
R2234:Hid1 UTSW 11 115,241,945 (GRCm39) missense probably damaging 1.00
R2235:Hid1 UTSW 11 115,241,945 (GRCm39) missense probably damaging 1.00
R2897:Hid1 UTSW 11 115,241,356 (GRCm39) missense probably benign
R2898:Hid1 UTSW 11 115,241,356 (GRCm39) missense probably benign
R3711:Hid1 UTSW 11 115,249,601 (GRCm39) missense probably damaging 1.00
R4059:Hid1 UTSW 11 115,247,565 (GRCm39) missense probably damaging 1.00
R4394:Hid1 UTSW 11 115,258,468 (GRCm39) utr 5 prime probably benign
R4478:Hid1 UTSW 11 115,252,481 (GRCm39) missense probably damaging 1.00
R4552:Hid1 UTSW 11 115,249,505 (GRCm39) missense possibly damaging 0.94
R4822:Hid1 UTSW 11 115,246,125 (GRCm39) missense probably damaging 1.00
R5691:Hid1 UTSW 11 115,239,645 (GRCm39) missense probably damaging 1.00
R5980:Hid1 UTSW 11 115,241,774 (GRCm39) missense possibly damaging 0.64
R5981:Hid1 UTSW 11 115,241,774 (GRCm39) missense possibly damaging 0.64
R6363:Hid1 UTSW 11 115,243,422 (GRCm39) missense probably damaging 1.00
R6577:Hid1 UTSW 11 115,245,462 (GRCm39) missense possibly damaging 0.89
R7191:Hid1 UTSW 11 115,239,295 (GRCm39) makesense probably null
R7307:Hid1 UTSW 11 115,239,308 (GRCm39) missense probably damaging 1.00
R7484:Hid1 UTSW 11 115,243,407 (GRCm39) splice site probably null
R7485:Hid1 UTSW 11 115,245,545 (GRCm39) missense probably damaging 1.00
R7836:Hid1 UTSW 11 115,249,821 (GRCm39) missense probably damaging 0.96
R7883:Hid1 UTSW 11 115,245,435 (GRCm39) missense probably damaging 1.00
R7904:Hid1 UTSW 11 115,246,187 (GRCm39) missense probably damaging 1.00
R8765:Hid1 UTSW 11 115,239,786 (GRCm39) critical splice acceptor site probably null
R9269:Hid1 UTSW 11 115,252,502 (GRCm39) missense probably damaging 0.99
R9598:Hid1 UTSW 11 115,239,738 (GRCm39) missense probably damaging 1.00
R9604:Hid1 UTSW 11 115,243,466 (GRCm39) missense
R9727:Hid1 UTSW 11 115,245,939 (GRCm39) missense probably damaging 1.00
X0025:Hid1 UTSW 11 115,239,629 (GRCm39) nonsense probably null
X0066:Hid1 UTSW 11 115,245,551 (GRCm39) missense probably damaging 1.00
Z1177:Hid1 UTSW 11 115,243,551 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGATGCCTCACTCTGGGTAATG -3'
(R):5'- TCTTGTCCTGGAAGTCAAAGCTGC -3'

Sequencing Primer
(F):5'- CCTCACTCTGGGTAATGAGTGC -3'
(R):5'- CTGCATTGACAAGTGAGTCC -3'
Posted On 2013-06-12