Incidental Mutation 'R0533:Hid1'
ID49335
Institutional Source Beutler Lab
Gene Symbol Hid1
Ensembl Gene ENSMUSG00000034586
Gene NameHID1 domain containing
SynonymsC630004H02Rik
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0533 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115347707-115367756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115348809 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 765 (I765N)
Ref Sequence ENSEMBL: ENSMUSP00000102152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000044152] [ENSMUST00000106542] [ENSMUST00000106543]
Predicted Effect probably benign
Transcript: ENSMUST00000019006
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044152
AA Change: I764N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043789
Gene: ENSMUSG00000034586
AA Change: I764N

DomainStartEndE-ValueType
Pfam:Dymeclin 1 763 3.9e-242 PFAM
Pfam:Hid1 1 784 3.1e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106542
AA Change: I765N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102152
Gene: ENSMUSG00000034586
AA Change: I765N

DomainStartEndE-ValueType
Pfam:Dymeclin 1 764 7.5e-275 PFAM
Pfam:Hid1 1 785 2.3e-261 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106543
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146256
Meta Mutation Damage Score 0.8257 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Hid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Hid1 APN 11 115359069 missense probably benign 0.05
IGL00783:Hid1 APN 11 115348510 missense probably damaging 1.00
IGL00935:Hid1 APN 11 115348498 missense probably damaging 1.00
IGL02081:Hid1 APN 11 115348506 missense possibly damaging 0.94
IGL02383:Hid1 APN 11 115352620 missense probably damaging 1.00
IGL02637:Hid1 APN 11 115350595 missense probably damaging 0.97
IGL03174:Hid1 APN 11 115360389 missense probably damaging 1.00
R0124:Hid1 UTSW 11 115356823 missense probably damaging 1.00
R1027:Hid1 UTSW 11 115355425 missense probably damaging 1.00
R1069:Hid1 UTSW 11 115356765 missense probably damaging 1.00
R1171:Hid1 UTSW 11 115352717 missense probably benign
R1583:Hid1 UTSW 11 115356750 missense possibly damaging 0.51
R1689:Hid1 UTSW 11 115360357 missense probably damaging 1.00
R1746:Hid1 UTSW 11 115354638 missense probably damaging 0.98
R1772:Hid1 UTSW 11 115348473 missense probably damaging 0.97
R1773:Hid1 UTSW 11 115348510 missense probably damaging 1.00
R1831:Hid1 UTSW 11 115348903 missense probably damaging 1.00
R2234:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2235:Hid1 UTSW 11 115351119 missense probably damaging 1.00
R2897:Hid1 UTSW 11 115350530 missense probably benign
R2898:Hid1 UTSW 11 115350530 missense probably benign
R3711:Hid1 UTSW 11 115358775 missense probably damaging 1.00
R4059:Hid1 UTSW 11 115356739 missense probably damaging 1.00
R4394:Hid1 UTSW 11 115367642 utr 5 prime probably benign
R4478:Hid1 UTSW 11 115361655 missense probably damaging 1.00
R4552:Hid1 UTSW 11 115358679 missense possibly damaging 0.94
R4822:Hid1 UTSW 11 115355299 missense probably damaging 1.00
R5691:Hid1 UTSW 11 115348819 missense probably damaging 1.00
R5980:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R5981:Hid1 UTSW 11 115350948 missense possibly damaging 0.64
R6363:Hid1 UTSW 11 115352596 missense probably damaging 1.00
R6577:Hid1 UTSW 11 115354636 missense possibly damaging 0.89
R7191:Hid1 UTSW 11 115348469 makesense probably null
R7307:Hid1 UTSW 11 115348482 missense probably damaging 1.00
R7485:Hid1 UTSW 11 115354719 missense probably damaging 1.00
X0025:Hid1 UTSW 11 115348803 nonsense probably null
X0066:Hid1 UTSW 11 115354725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGATGCCTCACTCTGGGTAATG -3'
(R):5'- TCTTGTCCTGGAAGTCAAAGCTGC -3'

Sequencing Primer
(F):5'- CCTCACTCTGGGTAATGAGTGC -3'
(R):5'- CTGCATTGACAAGTGAGTCC -3'
Posted On2013-06-12