Mutagenetix > Incidental Mutation

Incidental Mutation 'R0533:Sel1l'

49337

Institutional Source

Beutler Lab

Gene Symbol

Sel1l

Ensembl Gene

ENSMUSG00000020964

Gene Name

sel-1 suppressor of lin-12-like (C. elegans)

Synonyms

Sel1h

MMRRC Submission

038725-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0533 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

91806043-91849157 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 91820094 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 397 (F397Y)

Ref Sequence

ENSEMBL: ENSMUSP00000021347 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021347] [ENSMUST00000167466] [ENSMUST00000178462]

AlphaFold

Q9Z2G6

Predicted Effect

probably damaging
Transcript: ENSMUST00000021347
AA Change: F397Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000021347
Gene: ENSMUSG00000020964
AA Change: F397Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
FN2	116	164	1.24e-24	SMART
SEL1	179	214	2.48e-1	SMART
SEL1	215	250	7.5e1	SMART
SEL1	251	286	1.86e-5	SMART
SEL1	287	322	1.16e-1	SMART
SEL1	369	405	7.93e-9	SMART
SEL1	406	442	8.05e-10	SMART
SEL1	443	478	2.48e-10	SMART
SEL1	479	514	1.91e-11	SMART
SEL1	515	550	9.04e-4	SMART
Pfam:Sel1	585	622	3.4e-1	PFAM
SEL1	623	658	4.42e-7	SMART
SEL1	660	695	2.28e-9	SMART
low complexity region	766	790	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166691

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167466
AA Change: F347Y

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129384
Gene: ENSMUSG00000020964
AA Change: F347Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SEL1	129	164	2.48e-1	SMART
SEL1	165	200	7.5e1	SMART
SEL1	201	236	1.86e-5	SMART
SEL1	237	272	1.16e-1	SMART
SEL1	319	355	7.93e-9	SMART
SEL1	356	392	8.05e-10	SMART
SEL1	393	428	2.48e-10	SMART
SEL1	429	464	1.91e-11	SMART
SEL1	465	500	9.04e-4	SMART
Pfam:Sel1	534	572	1.5e-1	PFAM
SEL1	573	608	4.42e-7	SMART
SEL1	610	645	2.28e-9	SMART
low complexity region	716	740	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167594

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171465

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171959

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178462
AA Change: F347Y

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000136087
Gene: ENSMUSG00000020964
AA Change: F347Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SEL1	129	164	2.48e-1	SMART
SEL1	165	200	7.5e1	SMART
SEL1	201	236	1.86e-5	SMART
SEL1	237	272	1.16e-1	SMART
SEL1	319	355	7.93e-9	SMART
SEL1	356	392	8.05e-10	SMART
SEL1	393	428	2.48e-10	SMART
SEL1	429	464	1.91e-11	SMART
SEL1	465	500	9.04e-4	SMART
Pfam:Sel1	535	572	3.2e-1	PFAM
SEL1	573	608	4.42e-7	SMART
SEL1	610	645	2.28e-9	SMART
low complexity region	716	740	N/A	INTRINSIC

Meta Mutation Damage Score

0.4822

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protein complex required for the retrotranslocation or dislocation of misfolded proteins from the endoplasmic reticulum lumen to the cytosol, where they are degraded by the proteasome in a ubiquitin-dependent manner. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality with impaired exocrine and endocrine pancreatic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	G	8: 60,531,763		probably benign	Het
Abcb1b	A	T	5: 8,864,113		probably null	Het
Adcy10	A	G	1: 165,564,023	N1283S	probably benign	Het
Adgrb1	T	A	15: 74,541,559	W531R	probably damaging	Het
Ago4	A	G	4: 126,516,860	V246A	probably benign	Het
Arid5b	A	T	10: 68,186,033	D242E	probably damaging	Het
Arpp21	A	G	9: 112,126,505	V522A	probably benign	Het
Atg4b	T	A	1: 93,784,910		probably benign	Het
Capn12	T	C	7: 28,887,683	F359S	possibly damaging	Het
Ccdc88c	A	T	12: 100,954,282	I360N	probably damaging	Het
Clic3	A	G	2: 25,458,138	Y99C	probably damaging	Het
Cux1	T	C	5: 136,307,859	E925G	probably damaging	Het
Dnah10	G	A	5: 124,775,250		probably null	Het
Dnah17	A	G	11: 118,110,537	V860A	possibly damaging	Het
Etv5	C	T	16: 22,436,075		probably benign	Het
Fam83a	T	A	15: 58,009,811	N345K	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gm13089	G	T	4: 143,698,020	C284*	probably null	Het
Gpm6a	A	G	8: 55,055,374		probably null	Het
Grid1	T	A	14: 35,309,385	Y312N	possibly damaging	Het
Gstm4	T	C	3: 108,043,525	N51S	probably benign	Het
Hid1	A	T	11: 115,348,809	I765N	probably damaging	Het
Hmmr	A	G	11: 40,709,989	V518A	unknown	Het
Itgb6	A	G	2: 60,669,197	V84A	probably benign	Het
Kbtbd4	A	G	2: 90,907,604	K233E	probably benign	Het
Kif15	A	T	9: 123,009,433		probably benign	Het
Klre1	T	C	6: 129,583,193	S143P	probably damaging	Het
Krt81	T	C	15: 101,461,389	D216G	probably benign	Het
Mctp2	G	T	7: 72,080,822	H868Q	probably benign	Het
Morc2b	G	C	17: 33,135,932	Y955*	probably null	Het
Myog	A	C	1: 134,290,473	N140H	possibly damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Neil3	A	T	8: 53,638,775		probably null	Het
Nrg1	T	C	8: 31,831,245		probably null	Het
Olfr681	G	A	7: 105,122,350	V298I	probably benign	Het
Olfr689	A	T	7: 105,314,372	M123L	probably benign	Het
Olfr99	A	T	17: 37,280,291	L43*	probably null	Het
Pramef25	A	T	4: 143,950,720	D96E	possibly damaging	Het
Ptger2	T	A	14: 44,988,982	N6K	possibly damaging	Het
Ryr1	T	A	7: 29,078,780	E2097V	probably damaging	Het
Skint5	A	G	4: 113,827,867	V551A	unknown	Het
Slc39a12	A	G	2: 14,400,331	T245A	probably benign	Het
Syne1	C	T	10: 5,358,438	V706I	probably benign	Het
Tbc1d8	G	T	1: 39,372,774	Q994K	possibly damaging	Het
Tnrc6b	C	T	15: 80,876,653	T187I	probably benign	Het
Ttll6	G	A	11: 96,154,756	A600T	probably benign	Het
Ust	T	C	10: 8,248,080		probably benign	Het
Vmn2r71	GT	GTT	7: 85,619,218		probably null	Het
Vstm2a	C	T	11: 16,263,041	A142V	probably damaging	Het
Wfs1	T	A	5: 36,973,722		probably benign	Het
Wrap73	G	A	4: 154,151,649	G145D	probably damaging	Het
Wrap73	G	A	4: 154,156,154	V368M	possibly damaging	Het
Xrra1	T	A	7: 99,875,145		probably null	Het
Zfhx2	C	T	14: 55,064,090	V2146I	probably benign	Het
Zfp335	A	T	2: 164,907,922	L185*	probably null	Het

Other mutations in Sel1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Sel1l	APN	12	91814613	splice site	probably benign
IGL01082:Sel1l	APN	12	91811908	missense	probably benign	0.41
IGL01402:Sel1l	APN	12	91841833	missense	possibly damaging	0.55
IGL01610:Sel1l	APN	12	91817290	missense	probably damaging	1.00
IGL01690:Sel1l	APN	12	91843259	missense	probably benign
IGL01803:Sel1l	APN	12	91830730	missense	probably benign	0.37
IGL01939:Sel1l	APN	12	91816247	missense	probably damaging	1.00
IGL02275:Sel1l	APN	12	91815015	missense	probably damaging	1.00
IGL02279:Sel1l	APN	12	91814997	missense	probably damaging	1.00
IGL02407:Sel1l	APN	12	91843268	splice site	probably benign
IGL02934:Sel1l	APN	12	91809936	nonsense	probably null
R0565:Sel1l	UTSW	12	91811889	missense	probably benign	0.16
R0565:Sel1l	UTSW	12	91813945	missense	possibly damaging	0.95
R0973:Sel1l	UTSW	12	91824860	missense	probably damaging	1.00
R1378:Sel1l	UTSW	12	91833097	splice site	probably null
R1505:Sel1l	UTSW	12	91813962	missense	probably damaging	1.00
R1530:Sel1l	UTSW	12	91826684	missense	probably damaging	0.96
R2001:Sel1l	UTSW	12	91826550	nonsense	probably null
R3418:Sel1l	UTSW	12	91810002	missense	probably damaging	1.00
R3419:Sel1l	UTSW	12	91810002	missense	probably damaging	1.00
R4601:Sel1l	UTSW	12	91833053	critical splice donor site	probably null
R4776:Sel1l	UTSW	12	91813893	missense	probably damaging	1.00
R4839:Sel1l	UTSW	12	91833158	missense	probably benign	0.00
R4860:Sel1l	UTSW	12	91831602	missense	probably damaging	1.00
R4860:Sel1l	UTSW	12	91831602	missense	probably damaging	1.00
R4869:Sel1l	UTSW	12	91814054	intron	probably benign
R5261:Sel1l	UTSW	12	91824884	missense	possibly damaging	0.92
R5692:Sel1l	UTSW	12	91811878	missense	probably benign	0.02
R5744:Sel1l	UTSW	12	91809980	missense	possibly damaging	0.95
R5830:Sel1l	UTSW	12	91833171	missense	probably damaging	1.00
R6799:Sel1l	UTSW	12	91814968	splice site	probably null
R7291:Sel1l	UTSW	12	91848965	missense	probably benign
R8493:Sel1l	UTSW	12	91813961	nonsense	probably null
R9178:Sel1l	UTSW	12	91830752	missense	probably benign	0.05
R9179:Sel1l	UTSW	12	91811952	missense	probably benign	0.42
Z1176:Sel1l	UTSW	12	91825297	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTCTCACTCCACTGTGAAAAGA -3'
(R):5'- TGAAGTAAAGCTGCCTGACCCCTA -3'

Sequencing Primer
(F):5'- CAAACGCTACACTATGTCTAAGTTG -3'
(R):5'- CCTGATATTCCTGAAATAAGTG -3'

Posted On

2013-06-12