Incidental Mutation 'R0533:Sel1l'
ID 49337
Institutional Source Beutler Lab
Gene Symbol Sel1l
Ensembl Gene ENSMUSG00000020964
Gene Name sel-1 suppressor of lin-12-like (C. elegans)
Synonyms Sel1h
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0533 (G1)
Quality Score 91
Status Validated
Chromosome 12
Chromosomal Location 91806043-91849157 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91820094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 397 (F397Y)
Ref Sequence ENSEMBL: ENSMUSP00000021347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021347] [ENSMUST00000167466] [ENSMUST00000178462]
AlphaFold Q9Z2G6
Predicted Effect probably damaging
Transcript: ENSMUST00000021347
AA Change: F397Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021347
Gene: ENSMUSG00000020964
AA Change: F397Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FN2 116 164 1.24e-24 SMART
SEL1 179 214 2.48e-1 SMART
SEL1 215 250 7.5e1 SMART
SEL1 251 286 1.86e-5 SMART
SEL1 287 322 1.16e-1 SMART
SEL1 369 405 7.93e-9 SMART
SEL1 406 442 8.05e-10 SMART
SEL1 443 478 2.48e-10 SMART
SEL1 479 514 1.91e-11 SMART
SEL1 515 550 9.04e-4 SMART
Pfam:Sel1 585 622 3.4e-1 PFAM
SEL1 623 658 4.42e-7 SMART
SEL1 660 695 2.28e-9 SMART
low complexity region 766 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166691
Predicted Effect possibly damaging
Transcript: ENSMUST00000167466
AA Change: F347Y

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129384
Gene: ENSMUSG00000020964
AA Change: F347Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SEL1 129 164 2.48e-1 SMART
SEL1 165 200 7.5e1 SMART
SEL1 201 236 1.86e-5 SMART
SEL1 237 272 1.16e-1 SMART
SEL1 319 355 7.93e-9 SMART
SEL1 356 392 8.05e-10 SMART
SEL1 393 428 2.48e-10 SMART
SEL1 429 464 1.91e-11 SMART
SEL1 465 500 9.04e-4 SMART
Pfam:Sel1 534 572 1.5e-1 PFAM
SEL1 573 608 4.42e-7 SMART
SEL1 610 645 2.28e-9 SMART
low complexity region 716 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171959
Predicted Effect possibly damaging
Transcript: ENSMUST00000178462
AA Change: F347Y

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136087
Gene: ENSMUSG00000020964
AA Change: F347Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SEL1 129 164 2.48e-1 SMART
SEL1 165 200 7.5e1 SMART
SEL1 201 236 1.86e-5 SMART
SEL1 237 272 1.16e-1 SMART
SEL1 319 355 7.93e-9 SMART
SEL1 356 392 8.05e-10 SMART
SEL1 393 428 2.48e-10 SMART
SEL1 429 464 1.91e-11 SMART
SEL1 465 500 9.04e-4 SMART
Pfam:Sel1 535 572 3.2e-1 PFAM
SEL1 573 608 4.42e-7 SMART
SEL1 610 645 2.28e-9 SMART
low complexity region 716 740 N/A INTRINSIC
Meta Mutation Damage Score 0.4822 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protein complex required for the retrotranslocation or dislocation of misfolded proteins from the endoplasmic reticulum lumen to the cytosol, where they are degraded by the proteasome in a ubiquitin-dependent manner. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality with impaired exocrine and endocrine pancreatic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Sel1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sel1l APN 12 91814613 splice site probably benign
IGL01082:Sel1l APN 12 91811908 missense probably benign 0.41
IGL01402:Sel1l APN 12 91841833 missense possibly damaging 0.55
IGL01610:Sel1l APN 12 91817290 missense probably damaging 1.00
IGL01690:Sel1l APN 12 91843259 missense probably benign
IGL01803:Sel1l APN 12 91830730 missense probably benign 0.37
IGL01939:Sel1l APN 12 91816247 missense probably damaging 1.00
IGL02275:Sel1l APN 12 91815015 missense probably damaging 1.00
IGL02279:Sel1l APN 12 91814997 missense probably damaging 1.00
IGL02407:Sel1l APN 12 91843268 splice site probably benign
IGL02934:Sel1l APN 12 91809936 nonsense probably null
R0565:Sel1l UTSW 12 91811889 missense probably benign 0.16
R0565:Sel1l UTSW 12 91813945 missense possibly damaging 0.95
R0973:Sel1l UTSW 12 91824860 missense probably damaging 1.00
R1378:Sel1l UTSW 12 91833097 splice site probably null
R1505:Sel1l UTSW 12 91813962 missense probably damaging 1.00
R1530:Sel1l UTSW 12 91826684 missense probably damaging 0.96
R2001:Sel1l UTSW 12 91826550 nonsense probably null
R3418:Sel1l UTSW 12 91810002 missense probably damaging 1.00
R3419:Sel1l UTSW 12 91810002 missense probably damaging 1.00
R4601:Sel1l UTSW 12 91833053 critical splice donor site probably null
R4776:Sel1l UTSW 12 91813893 missense probably damaging 1.00
R4839:Sel1l UTSW 12 91833158 missense probably benign 0.00
R4860:Sel1l UTSW 12 91831602 missense probably damaging 1.00
R4860:Sel1l UTSW 12 91831602 missense probably damaging 1.00
R4869:Sel1l UTSW 12 91814054 intron probably benign
R5261:Sel1l UTSW 12 91824884 missense possibly damaging 0.92
R5692:Sel1l UTSW 12 91811878 missense probably benign 0.02
R5744:Sel1l UTSW 12 91809980 missense possibly damaging 0.95
R5830:Sel1l UTSW 12 91833171 missense probably damaging 1.00
R6799:Sel1l UTSW 12 91814968 splice site probably null
R7291:Sel1l UTSW 12 91848965 missense probably benign
R8493:Sel1l UTSW 12 91813961 nonsense probably null
R9178:Sel1l UTSW 12 91830752 missense probably benign 0.05
R9179:Sel1l UTSW 12 91811952 missense probably benign 0.42
Z1176:Sel1l UTSW 12 91825297 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTCTCACTCCACTGTGAAAAGA -3'
(R):5'- TGAAGTAAAGCTGCCTGACCCCTA -3'

Sequencing Primer
(F):5'- CAAACGCTACACTATGTCTAAGTTG -3'
(R):5'- CCTGATATTCCTGAAATAAGTG -3'
Posted On 2013-06-12