Incidental Mutation 'R0533:Naip2'
ID 49339
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene Name NLR family, apoptosis inhibitory protein 2
Synonyms Birc1b, Naip2, Naip-rs6
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R0533 (G1)
Quality Score 148
Status Validated
Chromosome 13
Chromosomal Location 100144063-100202092 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 100161782 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 582 (I582S)
Ref Sequence ENSEMBL: ENSMUSP00000113890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
AlphaFold Q9QUK4
Predicted Effect probably benign
Transcript: ENSMUST00000067975
AA Change: I582S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: I582S

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117913
AA Change: I582S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: I582S

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167986
AA Change: I582S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: I582S

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.3477 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0441:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155029 intron probably benign
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1913:Naip2 UTSW 13 100152157 critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3414:Naip2 UTSW 13 100189263 nonsense probably null
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
R7213:Naip2 UTSW 13 100187483 missense probably damaging 1.00
R7342:Naip2 UTSW 13 100189356 missense probably benign 0.09
R7445:Naip2 UTSW 13 100161782 missense probably benign 0.01
R7572:Naip2 UTSW 13 100154960 missense probably benign
R7699:Naip2 UTSW 13 100160369 missense probably benign 0.00
R7840:Naip2 UTSW 13 100144409 missense probably benign 0.14
R7874:Naip2 UTSW 13 100154951 missense probably benign 0.00
R7874:Naip2 UTSW 13 100154960 missense probably benign
R8038:Naip2 UTSW 13 100162062 missense probably benign 0.00
R8065:Naip2 UTSW 13 100189222 missense probably damaging 1.00
R8094:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8166:Naip2 UTSW 13 100162007 missense probably benign 0.03
R8378:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8669:Naip2 UTSW 13 100188969 missense probably benign 0.05
R8691:Naip2 UTSW 13 100161168 missense probably damaging 1.00
R8716:Naip2 UTSW 13 100144406 missense probably benign
R8720:Naip2 UTSW 13 100162122 missense probably benign 0.04
R8888:Naip2 UTSW 13 100189136 missense probably benign 0.01
R8895:Naip2 UTSW 13 100189136 missense probably benign 0.01
R9031:Naip2 UTSW 13 100178268 missense possibly damaging 0.55
R9072:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9072:Naip2 UTSW 13 100154960 missense probably benign
R9074:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9074:Naip2 UTSW 13 100154960 missense probably benign
R9077:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9077:Naip2 UTSW 13 100154960 missense probably benign
R9176:Naip2 UTSW 13 100162199 missense probably damaging 1.00
R9219:Naip2 UTSW 13 100160705 missense probably benign 0.06
R9358:Naip2 UTSW 13 100161572 missense probably damaging 1.00
R9371:Naip2 UTSW 13 100161846 nonsense probably null
R9414:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9415:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9416:Naip2 UTSW 13 100161735 missense probably damaging 1.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Z1176:Naip2 UTSW 13 100161593 missense probably benign 0.02
Z1176:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100152629 missense possibly damaging 0.65
Z1177:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100162865 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACATACTGCTGCCACGAAGAGGG -3'
(R):5'- TTCCGCCACATGAACTTGCCAG -3'

Sequencing Primer
(F):5'- GGGAAACTCTTTGATCTCTAGACTCG -3'
(R):5'- GCGATGTGTCCATCATTTCAAAG -3'
Posted On 2013-06-12