Incidental Mutation 'R0533:Grid1'
ID 49340
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Name glutamate receptor, ionotropic, delta 1
Synonyms GluRdelta1
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 34542065-35305336 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35031342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 312 (Y312N)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
AlphaFold Q61627
Predicted Effect possibly damaging
Transcript: ENSMUST00000043349
AA Change: Y312N

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: Y312N

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Meta Mutation Damage Score 0.1318 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Morc2b G C 17: 33,354,906 (GRCm39) Y955* probably null Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35,167,844 (GRCm39) missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34,544,596 (GRCm39) nonsense probably null
IGL01643:Grid1 APN 14 35,045,392 (GRCm39) critical splice donor site probably null
IGL01697:Grid1 APN 14 35,031,214 (GRCm39) missense probably benign 0.21
IGL01879:Grid1 APN 14 35,172,327 (GRCm39) missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35,045,383 (GRCm39) missense probably benign
IGL02515:Grid1 APN 14 35,174,302 (GRCm39) missense probably damaging 0.99
IGL02935:Grid1 APN 14 34,544,515 (GRCm39) missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34,667,722 (GRCm39) missense probably damaging 0.98
IGL03286:Grid1 APN 14 35,242,642 (GRCm39) splice site probably benign
IGL03296:Grid1 APN 14 35,302,524 (GRCm39) missense possibly damaging 0.52
IGL03305:Grid1 APN 14 34,973,664 (GRCm39) missense probably damaging 1.00
R0746:Grid1 UTSW 14 34,544,647 (GRCm39) missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34,544,576 (GRCm39) missense probably benign
R0812:Grid1 UTSW 14 34,544,576 (GRCm39) missense probably benign
R1144:Grid1 UTSW 14 35,284,633 (GRCm39) splice site probably benign
R1217:Grid1 UTSW 14 34,542,186 (GRCm39) start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34,544,540 (GRCm39) missense probably damaging 1.00
R1529:Grid1 UTSW 14 35,031,250 (GRCm39) missense probably benign 0.36
R1606:Grid1 UTSW 14 35,167,922 (GRCm39) missense probably damaging 0.96
R1691:Grid1 UTSW 14 35,174,286 (GRCm39) missense probably damaging 1.00
R1759:Grid1 UTSW 14 35,167,988 (GRCm39) missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35,043,764 (GRCm39) splice site probably benign
R2415:Grid1 UTSW 14 35,172,326 (GRCm39) missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35,284,516 (GRCm39) missense probably damaging 1.00
R3915:Grid1 UTSW 14 35,242,684 (GRCm39) missense probably damaging 1.00
R4044:Grid1 UTSW 14 35,172,358 (GRCm39) splice site probably benign
R4364:Grid1 UTSW 14 34,667,989 (GRCm39) missense probably benign 0.20
R4691:Grid1 UTSW 14 35,291,514 (GRCm39) missense probably benign
R4694:Grid1 UTSW 14 34,748,737 (GRCm39) missense probably damaging 1.00
R4749:Grid1 UTSW 14 35,302,644 (GRCm39) missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34,544,579 (GRCm39) missense probably damaging 0.99
R4854:Grid1 UTSW 14 35,043,598 (GRCm39) missense probably benign
R5555:Grid1 UTSW 14 35,242,662 (GRCm39) missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35,045,369 (GRCm39) missense probably damaging 1.00
R6176:Grid1 UTSW 14 35,284,504 (GRCm39) missense probably benign 0.00
R6569:Grid1 UTSW 14 35,045,296 (GRCm39) missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34,542,185 (GRCm39) start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35,284,470 (GRCm39) missense probably damaging 1.00
R7744:Grid1 UTSW 14 35,172,036 (GRCm39) missense probably damaging 1.00
R7795:Grid1 UTSW 14 35,043,642 (GRCm39) missense probably damaging 1.00
R7883:Grid1 UTSW 14 35,172,259 (GRCm39) splice site probably null
R7913:Grid1 UTSW 14 35,291,654 (GRCm39) missense probably damaging 0.99
R8032:Grid1 UTSW 14 35,045,316 (GRCm39) missense probably benign 0.00
R8333:Grid1 UTSW 14 35,291,595 (GRCm39) missense possibly damaging 0.82
R8916:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8928:Grid1 UTSW 14 35,302,723 (GRCm39) missense probably benign 0.25
R8934:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8935:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8939:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8986:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R8993:Grid1 UTSW 14 34,748,899 (GRCm39) missense probably benign 0.00
R9238:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9310:Grid1 UTSW 14 34,748,762 (GRCm39) missense probably damaging 1.00
R9332:Grid1 UTSW 14 35,045,360 (GRCm39) missense probably benign 0.06
R9335:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9336:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9478:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9479:Grid1 UTSW 14 35,043,664 (GRCm39) missense probably damaging 1.00
R9496:Grid1 UTSW 14 35,291,571 (GRCm39) missense probably damaging 1.00
R9583:Grid1 UTSW 14 35,302,492 (GRCm39) missense possibly damaging 0.90
R9601:Grid1 UTSW 14 35,167,814 (GRCm39) missense probably damaging 0.99
R9734:Grid1 UTSW 14 35,302,742 (GRCm39) missense probably benign
U24488:Grid1 UTSW 14 35,302,534 (GRCm39) missense probably benign 0.00
Z1088:Grid1 UTSW 14 35,174,251 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAATCAGTGACCCCGAGATCC -3'
(R):5'- CCTTAGCACTTAGCAGATGTGCCAG -3'

Sequencing Primer
(F):5'- CATCTGCAAAGGACAACCAG -3'
(R):5'- gatgtgccagggctgtg -3'
Posted On 2013-06-12