Mutagenetix > Incidental Mutation

Incidental Mutation 'R0533:Adgrb1'

49344

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

Bai1, B830018M07Rik

MMRRC Submission

038725-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0533 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

74516195-74589465 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74541559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 531 (W531R)

Ref Sequence

ENSEMBL: ENSMUSP00000140362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]

AlphaFold

Q3UHD1

Predicted Effect

probably damaging
Transcript: ENSMUST00000042035
AA Change: W531R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: W531R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186360
AA Change: W531R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: W531R

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187485

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189200

Meta Mutation Damage Score

0.9562

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	G	8: 60,531,763		probably benign	Het
Abcb1b	A	T	5: 8,864,113		probably null	Het
Adcy10	A	G	1: 165,564,023	N1283S	probably benign	Het
Ago4	A	G	4: 126,516,860	V246A	probably benign	Het
Arid5b	A	T	10: 68,186,033	D242E	probably damaging	Het
Arpp21	A	G	9: 112,126,505	V522A	probably benign	Het
Atg4b	T	A	1: 93,784,910		probably benign	Het
Capn12	T	C	7: 28,887,683	F359S	possibly damaging	Het
Ccdc88c	A	T	12: 100,954,282	I360N	probably damaging	Het
Clic3	A	G	2: 25,458,138	Y99C	probably damaging	Het
Cux1	T	C	5: 136,307,859	E925G	probably damaging	Het
Dnah10	G	A	5: 124,775,250		probably null	Het
Dnah17	A	G	11: 118,110,537	V860A	possibly damaging	Het
Etv5	C	T	16: 22,436,075		probably benign	Het
Fam83a	T	A	15: 58,009,811	N345K	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gm13089	G	T	4: 143,698,020	C284*	probably null	Het
Gpm6a	A	G	8: 55,055,374		probably null	Het
Grid1	T	A	14: 35,309,385	Y312N	possibly damaging	Het
Gstm4	T	C	3: 108,043,525	N51S	probably benign	Het
Hid1	A	T	11: 115,348,809	I765N	probably damaging	Het
Hmmr	A	G	11: 40,709,989	V518A	unknown	Het
Itgb6	A	G	2: 60,669,197	V84A	probably benign	Het
Kbtbd4	A	G	2: 90,907,604	K233E	probably benign	Het
Kif15	A	T	9: 123,009,433		probably benign	Het
Klre1	T	C	6: 129,583,193	S143P	probably damaging	Het
Krt81	T	C	15: 101,461,389	D216G	probably benign	Het
Mctp2	G	T	7: 72,080,822	H868Q	probably benign	Het
Morc2b	G	C	17: 33,135,932	Y955*	probably null	Het
Myog	A	C	1: 134,290,473	N140H	possibly damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Neil3	A	T	8: 53,638,775		probably null	Het
Nrg1	T	C	8: 31,831,245		probably null	Het
Olfr681	G	A	7: 105,122,350	V298I	probably benign	Het
Olfr689	A	T	7: 105,314,372	M123L	probably benign	Het
Olfr99	A	T	17: 37,280,291	L43*	probably null	Het
Pramef25	A	T	4: 143,950,720	D96E	possibly damaging	Het
Ptger2	T	A	14: 44,988,982	N6K	possibly damaging	Het
Ryr1	T	A	7: 29,078,780	E2097V	probably damaging	Het
Sel1l	A	T	12: 91,820,094	F397Y	probably damaging	Het
Skint5	A	G	4: 113,827,867	V551A	unknown	Het
Slc39a12	A	G	2: 14,400,331	T245A	probably benign	Het
Syne1	C	T	10: 5,358,438	V706I	probably benign	Het
Tbc1d8	G	T	1: 39,372,774	Q994K	possibly damaging	Het
Tnrc6b	C	T	15: 80,876,653	T187I	probably benign	Het
Ttll6	G	A	11: 96,154,756	A600T	probably benign	Het
Ust	T	C	10: 8,248,080		probably benign	Het
Vmn2r71	GT	GTT	7: 85,619,218		probably null	Het
Vstm2a	C	T	11: 16,263,041	A142V	probably damaging	Het
Wfs1	T	A	5: 36,973,722		probably benign	Het
Wrap73	G	A	4: 154,151,649	G145D	probably damaging	Het
Wrap73	G	A	4: 154,156,154	V368M	possibly damaging	Het
Xrra1	T	A	7: 99,875,145		probably null	Het
Zfhx2	C	T	14: 55,064,090	V2146I	probably benign	Het
Zfp335	A	T	2: 164,907,922	L185*	probably null	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74586835	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74548357	splice site	probably benign
IGL01874:Adgrb1	APN	15	74541574	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74541575	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74529782	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74540477	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74574112	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74586805	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74588294	splice site	probably benign
IGL02678:Adgrb1	APN	15	74538328	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74547622	missense	probably damaging	0.98
Bunting	UTSW	15	74543701	missense	probably null	0.94
BB005:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
BB015:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74541659	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74572156	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74586807	missense	probably benign
R0267:Adgrb1	UTSW	15	74529389	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74587149	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74543349	missense	probably damaging	0.97
R0635:Adgrb1	UTSW	15	74540892	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74548549	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74547685	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74550039	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74588107	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74529343	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74541827	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74529540	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74580586	nonsense	probably null
R1895:Adgrb1	UTSW	15	74540465	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74539877	splice site	probably benign
R2114:Adgrb1	UTSW	15	74540562	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74529908	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74547704	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74545015	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74588308	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74582943	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74543662	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74577453	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74584429	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74588114	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74529479	nonsense	probably null
R4760:Adgrb1	UTSW	15	74571463	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74588129	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74587022	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74572162	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74529815	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74543701	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74577499	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74550027	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74541574	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74538370	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74540459	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74588143	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74529361	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74550024	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74529901	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74574110	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74569881	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74569948	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74569884	missense	probably benign
R7283:Adgrb1	UTSW	15	74580663	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74548569	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74543638	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74541611	missense	probably benign	0.00
R8152:Adgrb1	UTSW	15	74545000	missense	probably damaging	0.98
R8198:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R8485:Adgrb1	UTSW	15	74548304	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74575851	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74543508	missense	probably damaging	0.97
R8865:Adgrb1	UTSW	15	74543658	missense	possibly damaging	0.75
R9044:Adgrb1	UTSW	15	74569899	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74543340	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74548626	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
Z1177:Adgrb1	UTSW	15	74541676	missense	probably damaging	1.00
Z1177:Adgrb1	UTSW	15	74547683	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCACATGAGATCCGGCTTCTTTTC -3'
(R):5'- GCAACACGAGCTTTGGGTATCAGAC -3'

Sequencing Primer
(F):5'- GAGTCAAGCTGATTTCAAACCTCTC -3'
(R):5'- AGACAACTACTCTTACCTGTGGC -3'

Posted On

2013-06-12