Mutagenetix > Incidental Mutation

Incidental Mutation 'R0533:Tnrc6b'

49345

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

038725-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R0533 (G1)

Quality Score

213

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80876653 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 187 (T187I)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

probably benign
Transcript: ENSMUST00000067689
AA Change: T187I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: T187I

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Meta Mutation Damage Score

0.1264

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (57/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	G	8: 60,531,763		probably benign	Het
Abcb1b	A	T	5: 8,864,113		probably null	Het
Adcy10	A	G	1: 165,564,023	N1283S	probably benign	Het
Adgrb1	T	A	15: 74,541,559	W531R	probably damaging	Het
Ago4	A	G	4: 126,516,860	V246A	probably benign	Het
Arid5b	A	T	10: 68,186,033	D242E	probably damaging	Het
Arpp21	A	G	9: 112,126,505	V522A	probably benign	Het
Atg4b	T	A	1: 93,784,910		probably benign	Het
Capn12	T	C	7: 28,887,683	F359S	possibly damaging	Het
Ccdc88c	A	T	12: 100,954,282	I360N	probably damaging	Het
Clic3	A	G	2: 25,458,138	Y99C	probably damaging	Het
Cux1	T	C	5: 136,307,859	E925G	probably damaging	Het
Dnah10	G	A	5: 124,775,250		probably null	Het
Dnah17	A	G	11: 118,110,537	V860A	possibly damaging	Het
Etv5	C	T	16: 22,436,075		probably benign	Het
Fam83a	T	A	15: 58,009,811	N345K	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gm13089	G	T	4: 143,698,020	C284*	probably null	Het
Gpm6a	A	G	8: 55,055,374		probably null	Het
Grid1	T	A	14: 35,309,385	Y312N	possibly damaging	Het
Gstm4	T	C	3: 108,043,525	N51S	probably benign	Het
Hid1	A	T	11: 115,348,809	I765N	probably damaging	Het
Hmmr	A	G	11: 40,709,989	V518A	unknown	Het
Itgb6	A	G	2: 60,669,197	V84A	probably benign	Het
Kbtbd4	A	G	2: 90,907,604	K233E	probably benign	Het
Kif15	A	T	9: 123,009,433		probably benign	Het
Klre1	T	C	6: 129,583,193	S143P	probably damaging	Het
Krt81	T	C	15: 101,461,389	D216G	probably benign	Het
Mctp2	G	T	7: 72,080,822	H868Q	probably benign	Het
Morc2b	G	C	17: 33,135,932	Y955*	probably null	Het
Myog	A	C	1: 134,290,473	N140H	possibly damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Neil3	A	T	8: 53,638,775		probably null	Het
Nrg1	T	C	8: 31,831,245		probably null	Het
Olfr681	G	A	7: 105,122,350	V298I	probably benign	Het
Olfr689	A	T	7: 105,314,372	M123L	probably benign	Het
Olfr99	A	T	17: 37,280,291	L43*	probably null	Het
Pramef25	A	T	4: 143,950,720	D96E	possibly damaging	Het
Ptger2	T	A	14: 44,988,982	N6K	possibly damaging	Het
Ryr1	T	A	7: 29,078,780	E2097V	probably damaging	Het
Sel1l	A	T	12: 91,820,094	F397Y	probably damaging	Het
Skint5	A	G	4: 113,827,867	V551A	unknown	Het
Slc39a12	A	G	2: 14,400,331	T245A	probably benign	Het
Syne1	C	T	10: 5,358,438	V706I	probably benign	Het
Tbc1d8	G	T	1: 39,372,774	Q994K	possibly damaging	Het
Ttll6	G	A	11: 96,154,756	A600T	probably benign	Het
Ust	T	C	10: 8,248,080		probably benign	Het
Vmn2r71	GT	GTT	7: 85,619,218		probably null	Het
Vstm2a	C	T	11: 16,263,041	A142V	probably damaging	Het
Wfs1	T	A	5: 36,973,722		probably benign	Het
Wrap73	G	A	4: 154,151,649	G145D	probably damaging	Het
Wrap73	G	A	4: 154,156,154	V368M	possibly damaging	Het
Xrra1	T	A	7: 99,875,145		probably null	Het
Zfhx2	C	T	14: 55,064,090	V2146I	probably benign	Het
Zfp335	A	T	2: 164,907,922	L185*	probably null	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
R9539:Tnrc6b	UTSW	15	80876343	missense	probably damaging	0.99
R9646:Tnrc6b	UTSW	15	80889065	missense	possibly damaging	0.89
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGCCCGAAGTGACGAAACCAAG -3'
(R):5'- GCTTTCATGTCAAGACAGCACAACC -3'

Sequencing Primer
(F):5'- ACCAGTCAATGGTGGCAAC -3'
(R):5'- CAACCCAGCTTAGAGAAGGGTC -3'

Posted On

2013-06-12