Incidental Mutation 'R0533:Krt81'
ID 49346
Institutional Source Beutler Lab
Gene Symbol Krt81
Ensembl Gene ENSMUSG00000067615
Gene Name keratin 81
Synonyms Krt2-19
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 101459061-101463751 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101461389 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 216 (D216G)
Ref Sequence ENSEMBL: ENSMUSP00000056525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061185]
AlphaFold Q9ERE2
Predicted Effect probably benign
Transcript: ENSMUST00000061185
AA Change: D216G

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056525
Gene: ENSMUSG00000067615
AA Change: D216G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 102 5.6e-15 PFAM
Filament 105 416 6.92e-148 SMART
low complexity region 424 438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230541
Meta Mutation Damage Score 0.5587 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB3 and KRTHB6, is found primarily in the hair cortex. Mutations in this gene and KRTHB6 have been observed in patients with a rare dominant hair disease, monilethrix. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Krt81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Krt81 APN 15 101460278 missense probably benign 0.01
IGL01012:Krt81 APN 15 101461019 missense probably benign 0.05
IGL01287:Krt81 APN 15 101463388 missense probably benign 0.00
IGL01304:Krt81 APN 15 101463388 missense probably benign 0.00
IGL01319:Krt81 APN 15 101463388 missense probably benign 0.00
IGL01403:Krt81 APN 15 101463388 missense probably benign 0.00
PIT4508001:Krt81 UTSW 15 101462725 missense probably damaging 1.00
R0083:Krt81 UTSW 15 101463465 missense probably damaging 1.00
R0097:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0099:Krt81 UTSW 15 101463521 nonsense probably null
R0110:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0112:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0196:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0449:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0450:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0482:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0510:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0511:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0512:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0514:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0639:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0674:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R0692:Krt81 UTSW 15 101460172 missense possibly damaging 0.91
R0737:Krt81 UTSW 15 101463627 missense possibly damaging 0.81
R1458:Krt81 UTSW 15 101460317 missense probably benign 0.34
R1824:Krt81 UTSW 15 101460139 missense probably damaging 0.98
R1991:Krt81 UTSW 15 101462554 missense probably benign 0.01
R2338:Krt81 UTSW 15 101463336 missense probably benign 0.25
R4169:Krt81 UTSW 15 101461312 missense probably benign
R4170:Krt81 UTSW 15 101461312 missense probably benign
R5267:Krt81 UTSW 15 101459459 missense probably benign
R5903:Krt81 UTSW 15 101460202 missense probably damaging 1.00
R6306:Krt81 UTSW 15 101459523 missense probably benign 0.01
R7055:Krt81 UTSW 15 101461125 missense probably benign 0.43
R7069:Krt81 UTSW 15 101460728 missense possibly damaging 0.75
R7191:Krt81 UTSW 15 101460229 missense probably damaging 1.00
R7441:Krt81 UTSW 15 101461370 missense possibly damaging 0.95
R7727:Krt81 UTSW 15 101459567 missense probably damaging 1.00
R7728:Krt81 UTSW 15 101460206 missense probably damaging 1.00
R7733:Krt81 UTSW 15 101463514 missense probably damaging 0.96
R8460:Krt81 UTSW 15 101463612 missense probably damaging 0.98
R9324:Krt81 UTSW 15 101463454 missense probably damaging 0.99
R9597:Krt81 UTSW 15 101461038 missense probably benign 0.06
R9638:Krt81 UTSW 15 101460975 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACGACACAGTCCATGTTCAGGTCC -3'
(R):5'- GAGAGTCTCCACAGAAAAGAGCTGC -3'

Sequencing Primer
(F):5'- TCTTGAAGGCTCAGCCTAAC -3'
(R):5'- CAGAAAAGAGCTGCCAAGTGC -3'
Posted On 2013-06-12