Mutagenetix > Incidental Mutation

Incidental Mutation 'R0533:Krt81'

49346

Institutional Source

Beutler Lab

Gene Symbol

Krt81

Ensembl Gene

ENSMUSG00000067615

Gene Name

keratin 81

Synonyms

Krt2-19

MMRRC Submission

038725-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R0533 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101459061-101463751 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101461389 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 216 (D216G)

Ref Sequence

ENSEMBL: ENSMUSP00000056525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061185]

AlphaFold

Q9ERE2

Predicted Effect

probably benign
Transcript: ENSMUST00000061185
AA Change: D216G

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000056525
Gene: ENSMUSG00000067615
AA Change: D216G

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	2	102	5.6e-15	PFAM
Filament	105	416	6.92e-148	SMART
low complexity region	424	438	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230541

Meta Mutation Damage Score

0.5587

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.5%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB3 and KRTHB6, is found primarily in the hair cortex. Mutations in this gene and KRTHB6 have been observed in patients with a rare dominant hair disease, monilethrix. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	G	8: 60,531,763		probably benign	Het
Abcb1b	A	T	5: 8,864,113		probably null	Het
Adcy10	A	G	1: 165,564,023	N1283S	probably benign	Het
Adgrb1	T	A	15: 74,541,559	W531R	probably damaging	Het
Ago4	A	G	4: 126,516,860	V246A	probably benign	Het
Arid5b	A	T	10: 68,186,033	D242E	probably damaging	Het
Arpp21	A	G	9: 112,126,505	V522A	probably benign	Het
Atg4b	T	A	1: 93,784,910		probably benign	Het
Capn12	T	C	7: 28,887,683	F359S	possibly damaging	Het
Ccdc88c	A	T	12: 100,954,282	I360N	probably damaging	Het
Clic3	A	G	2: 25,458,138	Y99C	probably damaging	Het
Cux1	T	C	5: 136,307,859	E925G	probably damaging	Het
Dnah10	G	A	5: 124,775,250		probably null	Het
Dnah17	A	G	11: 118,110,537	V860A	possibly damaging	Het
Etv5	C	T	16: 22,436,075		probably benign	Het
Fam83a	T	A	15: 58,009,811	N345K	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gm13089	G	T	4: 143,698,020	C284*	probably null	Het
Gpm6a	A	G	8: 55,055,374		probably null	Het
Grid1	T	A	14: 35,309,385	Y312N	possibly damaging	Het
Gstm4	T	C	3: 108,043,525	N51S	probably benign	Het
Hid1	A	T	11: 115,348,809	I765N	probably damaging	Het
Hmmr	A	G	11: 40,709,989	V518A	unknown	Het
Itgb6	A	G	2: 60,669,197	V84A	probably benign	Het
Kbtbd4	A	G	2: 90,907,604	K233E	probably benign	Het
Kif15	A	T	9: 123,009,433		probably benign	Het
Klre1	T	C	6: 129,583,193	S143P	probably damaging	Het
Mctp2	G	T	7: 72,080,822	H868Q	probably benign	Het
Morc2b	G	C	17: 33,135,932	Y955*	probably null	Het
Myog	A	C	1: 134,290,473	N140H	possibly damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Naip2	A	C	13: 100,161,782	I582S	probably benign	Het
Neil3	A	T	8: 53,638,775		probably null	Het
Nrg1	T	C	8: 31,831,245		probably null	Het
Olfr681	G	A	7: 105,122,350	V298I	probably benign	Het
Olfr689	A	T	7: 105,314,372	M123L	probably benign	Het
Olfr99	A	T	17: 37,280,291	L43*	probably null	Het
Pramef25	A	T	4: 143,950,720	D96E	possibly damaging	Het
Ptger2	T	A	14: 44,988,982	N6K	possibly damaging	Het
Ryr1	T	A	7: 29,078,780	E2097V	probably damaging	Het
Sel1l	A	T	12: 91,820,094	F397Y	probably damaging	Het
Skint5	A	G	4: 113,827,867	V551A	unknown	Het
Slc39a12	A	G	2: 14,400,331	T245A	probably benign	Het
Syne1	C	T	10: 5,358,438	V706I	probably benign	Het
Tbc1d8	G	T	1: 39,372,774	Q994K	possibly damaging	Het
Tnrc6b	C	T	15: 80,876,653	T187I	probably benign	Het
Ttll6	G	A	11: 96,154,756	A600T	probably benign	Het
Ust	T	C	10: 8,248,080		probably benign	Het
Vmn2r71	GT	GTT	7: 85,619,218		probably null	Het
Vstm2a	C	T	11: 16,263,041	A142V	probably damaging	Het
Wfs1	T	A	5: 36,973,722		probably benign	Het
Wrap73	G	A	4: 154,151,649	G145D	probably damaging	Het
Wrap73	G	A	4: 154,156,154	V368M	possibly damaging	Het
Xrra1	T	A	7: 99,875,145		probably null	Het
Zfhx2	C	T	14: 55,064,090	V2146I	probably benign	Het
Zfp335	A	T	2: 164,907,922	L185*	probably null	Het

Other mutations in Krt81

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Krt81	APN	15	101460278	missense	probably benign	0.01
IGL01012:Krt81	APN	15	101461019	missense	probably benign	0.05
IGL01287:Krt81	APN	15	101463388	missense	probably benign	0.00
IGL01304:Krt81	APN	15	101463388	missense	probably benign	0.00
IGL01319:Krt81	APN	15	101463388	missense	probably benign	0.00
IGL01403:Krt81	APN	15	101463388	missense	probably benign	0.00
PIT4508001:Krt81	UTSW	15	101462725	missense	probably damaging	1.00
R0083:Krt81	UTSW	15	101463465	missense	probably damaging	1.00
R0097:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0099:Krt81	UTSW	15	101463521	nonsense	probably null
R0110:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0112:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0196:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0449:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0450:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0482:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0510:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0511:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0512:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0514:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0639:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0674:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R0692:Krt81	UTSW	15	101460172	missense	possibly damaging	0.91
R0737:Krt81	UTSW	15	101463627	missense	possibly damaging	0.81
R1458:Krt81	UTSW	15	101460317	missense	probably benign	0.34
R1824:Krt81	UTSW	15	101460139	missense	probably damaging	0.98
R1991:Krt81	UTSW	15	101462554	missense	probably benign	0.01
R2338:Krt81	UTSW	15	101463336	missense	probably benign	0.25
R4169:Krt81	UTSW	15	101461312	missense	probably benign
R4170:Krt81	UTSW	15	101461312	missense	probably benign
R5267:Krt81	UTSW	15	101459459	missense	probably benign
R5903:Krt81	UTSW	15	101460202	missense	probably damaging	1.00
R6306:Krt81	UTSW	15	101459523	missense	probably benign	0.01
R7055:Krt81	UTSW	15	101461125	missense	probably benign	0.43
R7069:Krt81	UTSW	15	101460728	missense	possibly damaging	0.75
R7191:Krt81	UTSW	15	101460229	missense	probably damaging	1.00
R7441:Krt81	UTSW	15	101461370	missense	possibly damaging	0.95
R7727:Krt81	UTSW	15	101459567	missense	probably damaging	1.00
R7728:Krt81	UTSW	15	101460206	missense	probably damaging	1.00
R7733:Krt81	UTSW	15	101463514	missense	probably damaging	0.96
R8460:Krt81	UTSW	15	101463612	missense	probably damaging	0.98
R9324:Krt81	UTSW	15	101463454	missense	probably damaging	0.99
R9597:Krt81	UTSW	15	101461038	missense	probably benign	0.06
R9638:Krt81	UTSW	15	101460975	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ACGACACAGTCCATGTTCAGGTCC -3'
(R):5'- GAGAGTCTCCACAGAAAAGAGCTGC -3'

Sequencing Primer
(F):5'- TCTTGAAGGCTCAGCCTAAC -3'
(R):5'- CAGAAAAGAGCTGCCAAGTGC -3'

Posted On

2013-06-12