Incidental Mutation 'R0533:Morc2b'
ID 49348
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Name microrchidia 2B
Synonyms
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 33135588-33139683 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to C at 33135932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 955 (Y955*)
Ref Sequence ENSEMBL: ENSMUSP00000123354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
AlphaFold Q8C5W4
Predicted Effect probably null
Transcript: ENSMUST00000053896
AA Change: Y955*
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: Y955*

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131954
AA Change: Y955*
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: Y955*

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Arpp21 A G 9: 112,126,505 V522A probably benign Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
twinkle UTSW 17 33135932 nonsense probably null
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
R7754:Morc2b UTSW 17 33137244 missense probably benign 0.33
R7756:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7758:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7766:Morc2b UTSW 17 33138423 missense probably benign 0.19
R7957:Morc2b UTSW 17 33135773 missense probably benign 0.39
R7965:Morc2b UTSW 17 33135772 missense possibly damaging 0.91
R8164:Morc2b UTSW 17 33138040 missense probably damaging 0.99
R8283:Morc2b UTSW 17 33136701 missense probably benign 0.00
R8338:Morc2b UTSW 17 33136413 missense probably benign
R8349:Morc2b UTSW 17 33136801 missense probably benign 0.13
R8352:Morc2b UTSW 17 33137502 missense probably damaging 1.00
R8362:Morc2b UTSW 17 33138321 missense possibly damaging 0.91
R8364:Morc2b UTSW 17 33138240 missense probably benign 0.01
R8449:Morc2b UTSW 17 33136801 missense probably benign 0.13
R8452:Morc2b UTSW 17 33137502 missense probably damaging 1.00
R8476:Morc2b UTSW 17 33135859 missense possibly damaging 0.87
R8844:Morc2b UTSW 17 33135768 missense probably damaging 1.00
R9277:Morc2b UTSW 17 33136023 missense probably benign 0.10
R9571:Morc2b UTSW 17 33136204 missense probably benign 0.00
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33137402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATCTAGCTCATCATCTGCCC -3'
(R):5'- GAATGCTTCTGCACTGAACCCGAC -3'

Sequencing Primer
(F):5'- CTGATGTTTATGCCCTGCTGAG -3'
(R):5'- ACAAGACCATTGACCTCTTGG -3'
Posted On 2013-06-12