Incidental Mutation 'R0533:Morc2b'
ID 49348
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Name microrchidia 2B
Synonyms 4932411A10Rik
MMRRC Submission 038725-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.274) question?
Stock # R0533 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 33354562-33369473 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to C at 33354906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 955 (Y955*)
Ref Sequence ENSEMBL: ENSMUSP00000123354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
AlphaFold Q8C5W4
Predicted Effect probably null
Transcript: ENSMUST00000053896
AA Change: Y955*
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: Y955*

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131954
AA Change: Y955*
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: Y955*

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,984,797 (GRCm39) probably benign Het
Abcb1b A T 5: 8,914,113 (GRCm39) probably null Het
Adcy10 A G 1: 165,391,592 (GRCm39) N1283S probably benign Het
Adgrb1 T A 15: 74,413,408 (GRCm39) W531R probably damaging Het
Ago4 A G 4: 126,410,653 (GRCm39) V246A probably benign Het
Arid5b A T 10: 68,021,863 (GRCm39) D242E probably damaging Het
Arpp21 A G 9: 111,955,573 (GRCm39) V522A probably benign Het
Atg4b T A 1: 93,712,632 (GRCm39) probably benign Het
Capn12 T C 7: 28,587,108 (GRCm39) F359S possibly damaging Het
Ccdc88c A T 12: 100,920,541 (GRCm39) I360N probably damaging Het
Clic3 A G 2: 25,348,150 (GRCm39) Y99C probably damaging Het
Cux1 T C 5: 136,336,713 (GRCm39) E925G probably damaging Het
Dnah10 G A 5: 124,852,314 (GRCm39) probably null Het
Dnah17 A G 11: 118,001,363 (GRCm39) V860A possibly damaging Het
Etv5 C T 16: 22,254,825 (GRCm39) probably benign Het
Fam83a T A 15: 57,873,207 (GRCm39) N345K probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gpm6a A G 8: 55,508,409 (GRCm39) probably null Het
Grid1 T A 14: 35,031,342 (GRCm39) Y312N possibly damaging Het
Gstm4 T C 3: 107,950,841 (GRCm39) N51S probably benign Het
Hid1 A T 11: 115,239,635 (GRCm39) I765N probably damaging Het
Hmmr A G 11: 40,600,816 (GRCm39) V518A unknown Het
Itgb6 A G 2: 60,499,541 (GRCm39) V84A probably benign Het
Kbtbd4 A G 2: 90,737,948 (GRCm39) K233E probably benign Het
Kif15 A T 9: 122,838,498 (GRCm39) probably benign Het
Klre1 T C 6: 129,560,156 (GRCm39) S143P probably damaging Het
Krt81 T C 15: 101,359,270 (GRCm39) D216G probably benign Het
Mctp2 G T 7: 71,730,570 (GRCm39) H868Q probably benign Het
Myog A C 1: 134,218,211 (GRCm39) N140H possibly damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Neil3 A T 8: 54,091,810 (GRCm39) probably null Het
Nrg1 T C 8: 32,321,273 (GRCm39) probably null Het
Or1o4 A T 17: 37,591,182 (GRCm39) L43* probably null Het
Or56a3b G A 7: 104,771,557 (GRCm39) V298I probably benign Het
Or56b35 A T 7: 104,963,579 (GRCm39) M123L probably benign Het
Pramel16 A T 4: 143,677,290 (GRCm39) D96E possibly damaging Het
Pramel23 G T 4: 143,424,590 (GRCm39) C284* probably null Het
Ptger2 T A 14: 45,226,439 (GRCm39) N6K possibly damaging Het
Ryr1 T A 7: 28,778,205 (GRCm39) E2097V probably damaging Het
Sel1l A T 12: 91,786,868 (GRCm39) F397Y probably damaging Het
Skint5 A G 4: 113,685,064 (GRCm39) V551A unknown Het
Slc39a12 A G 2: 14,405,142 (GRCm39) T245A probably benign Het
Syne1 C T 10: 5,308,438 (GRCm39) V706I probably benign Het
Tbc1d8 G T 1: 39,411,855 (GRCm39) Q994K possibly damaging Het
Tnrc6b C T 15: 80,760,854 (GRCm39) T187I probably benign Het
Ttll6 G A 11: 96,045,582 (GRCm39) A600T probably benign Het
Ust T C 10: 8,123,844 (GRCm39) probably benign Het
Vmn2r71 GT GTT 7: 85,268,426 (GRCm39) probably null Het
Vstm2a C T 11: 16,213,041 (GRCm39) A142V probably damaging Het
Wfs1 T A 5: 37,131,066 (GRCm39) probably benign Het
Wrap73 G A 4: 154,236,106 (GRCm39) G145D probably damaging Het
Wrap73 G A 4: 154,240,611 (GRCm39) V368M possibly damaging Het
Xrra1 T A 7: 99,524,352 (GRCm39) probably null Het
Zfhx2 C T 14: 55,301,547 (GRCm39) V2146I probably benign Het
Zfp335 A T 2: 164,749,842 (GRCm39) L185* probably null Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33,356,293 (GRCm39) missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33,357,139 (GRCm39) missense probably benign 0.12
IGL01533:Morc2b APN 17 33,354,695 (GRCm39) utr 3 prime probably benign
IGL02003:Morc2b APN 17 33,357,298 (GRCm39) missense probably benign 0.07
IGL02028:Morc2b APN 17 33,356,387 (GRCm39) missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33,356,917 (GRCm39) missense probably damaging 1.00
IGL02341:Morc2b APN 17 33,356,281 (GRCm39) missense probably damaging 1.00
IGL02976:Morc2b APN 17 33,356,497 (GRCm39) missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33,357,337 (GRCm39) missense probably damaging 1.00
twinkle UTSW 17 33,354,906 (GRCm39) nonsense probably null
PIT4283001:Morc2b UTSW 17 33,355,042 (GRCm39) missense probably benign 0.00
R0056:Morc2b UTSW 17 33,357,733 (GRCm39) missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33,356,015 (GRCm39) missense probably damaging 1.00
R0179:Morc2b UTSW 17 33,355,956 (GRCm39) nonsense probably null
R0556:Morc2b UTSW 17 33,356,812 (GRCm39) missense probably benign 0.05
R0629:Morc2b UTSW 17 33,354,781 (GRCm39) missense probably benign 0.00
R0635:Morc2b UTSW 17 33,356,661 (GRCm39) missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33,355,086 (GRCm39) missense probably benign 0.01
R1205:Morc2b UTSW 17 33,354,908 (GRCm39) missense probably damaging 1.00
R1566:Morc2b UTSW 17 33,355,948 (GRCm39) missense probably benign 0.02
R1676:Morc2b UTSW 17 33,354,955 (GRCm39) missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33,354,748 (GRCm39) missense probably damaging 1.00
R1954:Morc2b UTSW 17 33,356,464 (GRCm39) missense probably damaging 1.00
R1955:Morc2b UTSW 17 33,356,464 (GRCm39) missense probably damaging 1.00
R1969:Morc2b UTSW 17 33,356,065 (GRCm39) missense probably benign 0.00
R2069:Morc2b UTSW 17 33,355,734 (GRCm39) missense probably benign 0.13
R3609:Morc2b UTSW 17 33,355,252 (GRCm39) missense probably damaging 1.00
R3610:Morc2b UTSW 17 33,355,252 (GRCm39) missense probably damaging 1.00
R3831:Morc2b UTSW 17 33,356,233 (GRCm39) missense probably benign 0.01
R4156:Morc2b UTSW 17 33,357,401 (GRCm39) missense probably benign 0.43
R4243:Morc2b UTSW 17 33,355,375 (GRCm39) missense probably benign 0.03
R4877:Morc2b UTSW 17 33,357,712 (GRCm39) missense probably benign 0.26
R4911:Morc2b UTSW 17 33,356,351 (GRCm39) missense probably damaging 1.00
R5230:Morc2b UTSW 17 33,355,226 (GRCm39) missense probably benign 0.00
R5264:Morc2b UTSW 17 33,357,353 (GRCm39) missense probably benign 0.03
R5326:Morc2b UTSW 17 33,355,907 (GRCm39) missense probably benign 0.01
R5455:Morc2b UTSW 17 33,357,584 (GRCm39) missense probably benign 0.29
R5933:Morc2b UTSW 17 33,357,583 (GRCm39) missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33,356,446 (GRCm39) missense probably damaging 0.97
R6026:Morc2b UTSW 17 33,356,957 (GRCm39) missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33,357,042 (GRCm39) nonsense probably null
R6393:Morc2b UTSW 17 33,356,750 (GRCm39) missense probably damaging 0.97
R7066:Morc2b UTSW 17 33,355,610 (GRCm39) missense probably benign 0.00
R7117:Morc2b UTSW 17 33,356,926 (GRCm39) missense probably benign 0.00
R7120:Morc2b UTSW 17 33,354,787 (GRCm39) missense probably damaging 1.00
R7130:Morc2b UTSW 17 33,355,262 (GRCm39) missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33,356,833 (GRCm39) missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33,356,435 (GRCm39) missense probably benign 0.03
R7664:Morc2b UTSW 17 33,355,376 (GRCm39) missense probably benign 0.12
R7754:Morc2b UTSW 17 33,356,218 (GRCm39) missense probably benign 0.33
R7756:Morc2b UTSW 17 33,355,981 (GRCm39) missense probably damaging 1.00
R7758:Morc2b UTSW 17 33,355,981 (GRCm39) missense probably damaging 1.00
R7766:Morc2b UTSW 17 33,357,397 (GRCm39) missense probably benign 0.19
R7957:Morc2b UTSW 17 33,354,747 (GRCm39) missense probably benign 0.39
R7965:Morc2b UTSW 17 33,354,746 (GRCm39) missense possibly damaging 0.91
R8164:Morc2b UTSW 17 33,357,014 (GRCm39) missense probably damaging 0.99
R8283:Morc2b UTSW 17 33,355,675 (GRCm39) missense probably benign 0.00
R8338:Morc2b UTSW 17 33,355,387 (GRCm39) missense probably benign
R8349:Morc2b UTSW 17 33,355,775 (GRCm39) missense probably benign 0.13
R8352:Morc2b UTSW 17 33,356,476 (GRCm39) missense probably damaging 1.00
R8362:Morc2b UTSW 17 33,357,295 (GRCm39) missense possibly damaging 0.91
R8364:Morc2b UTSW 17 33,357,214 (GRCm39) missense probably benign 0.01
R8449:Morc2b UTSW 17 33,355,775 (GRCm39) missense probably benign 0.13
R8452:Morc2b UTSW 17 33,356,476 (GRCm39) missense probably damaging 1.00
R8476:Morc2b UTSW 17 33,354,833 (GRCm39) missense possibly damaging 0.87
R8844:Morc2b UTSW 17 33,354,742 (GRCm39) missense probably damaging 1.00
R9277:Morc2b UTSW 17 33,354,997 (GRCm39) missense probably benign 0.10
R9571:Morc2b UTSW 17 33,355,178 (GRCm39) missense probably benign 0.00
Z1088:Morc2b UTSW 17 33,355,060 (GRCm39) missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33,356,376 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATCTAGCTCATCATCTGCCC -3'
(R):5'- GAATGCTTCTGCACTGAACCCGAC -3'

Sequencing Primer
(F):5'- CTGATGTTTATGCCCTGCTGAG -3'
(R):5'- ACAAGACCATTGACCTCTTGG -3'
Posted On 2013-06-12